Incidental Mutation 'R9020:Sycp1'
ID686644
Institutional Source Beutler Lab
Gene Symbol Sycp1
Ensembl Gene ENSMUSG00000027855
Gene Namesynaptonemal complex protein 1
SynonymsSCP1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.428) question?
Stock #R9020 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location102818499-102936100 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102876337 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 607 (K607R)
Ref Sequence ENSEMBL: ENSMUSP00000029448 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029448] [ENSMUST00000196988]
AlphaFold Q62209
Predicted Effect probably benign
Transcript: ENSMUST00000029448
AA Change: K607R

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000029448
Gene: ENSMUSG00000027855
AA Change: K607R

DomainStartEndE-ValueType
Pfam:SCP-1 28 809 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196988
AA Change: K607R

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000143651
Gene: ENSMUSG00000027855
AA Change: K607R

DomainStartEndE-ValueType
Pfam:SCP-1 28 809 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice display male and female infertility, azoospermia, small ovary, small testis and seminiferous tubules, absent ovarian follicles, and failure of synapse formation during meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot11 A G 4: 106,748,418 S586P probably damaging Het
Adora3 T A 3: 105,907,825 I297N probably damaging Het
Adrb3 A T 8: 27,227,919 F167L probably damaging Het
Apob A G 12: 8,013,999 Y3955C probably damaging Het
Atp2a1 T C 7: 126,446,963 D963G probably benign Het
Btbd10 T C 7: 113,351,850 N11S possibly damaging Het
Casr A G 16: 36,495,249 S820P probably damaging Het
Ccdc82 C T 9: 13,281,425 R447C probably damaging Het
Cfap44 T A 16: 44,437,159 V1019E probably damaging Het
Cfap65 T C 1: 74,920,393 E866G probably damaging Het
Chd4 T A 6: 125,107,506 D713E probably damaging Het
Ctdsp1 T C 1: 74,395,517 F240S possibly damaging Het
Cyp26b1 C T 6: 84,575,074 V361I probably benign Het
Dmbt1 T A 7: 131,111,058 I1597N possibly damaging Het
Dnajc25 C A 4: 59,003,470 Y80* probably null Het
Fbxo17 A T 7: 28,737,357 N246Y possibly damaging Het
Filip1l A G 16: 57,570,695 T549A probably benign Het
Gm9758 A C 5: 14,914,725 N35K Het
Gtf2i T C 5: 134,246,561 T707A probably benign Het
Ifnk T C 4: 35,152,573 V167A probably damaging Het
Iqch T C 9: 63,525,244 M290V probably benign Het
Irx1 A T 13: 71,963,429 Y20* probably null Het
Jade2 T A 11: 51,817,627 Q572L probably benign Het
Kcne4 T A 1: 78,817,708 H24Q probably benign Het
Kcnt2 T A 1: 140,584,311 V1068E probably benign Het
Klk1b27 T A 7: 44,055,694 V95D probably damaging Het
Lins1 A G 7: 66,708,213 D32G probably damaging Het
Mavs A G 2: 131,246,674 E466G possibly damaging Het
Mipep T A 14: 60,831,228 L483* probably null Het
Muc16 G GAATGGCTTTCTT 9: 18,638,719 probably benign Het
Myo1a C A 10: 127,714,123 Q491K probably benign Het
Nle1 C G 11: 82,906,449 E146Q probably benign Het
Nphp3 T C 9: 104,031,951 Y787H probably benign Het
Pcdh15 A G 10: 74,645,611 S263G probably benign Het
Pcdhb8 T G 18: 37,356,784 I505S probably damaging Het
Phtf1 C G 3: 103,991,378 S339* probably null Het
Pip5k1b T A 19: 24,350,221 I424F probably benign Het
Plxna4 T A 6: 32,234,562 T681S possibly damaging Het
Prdm1 A G 10: 44,440,040 L700P probably damaging Het
Prtg C T 9: 72,891,995 T769I probably damaging Het
Rasgrf2 A G 13: 92,028,638 V340A possibly damaging Het
Ros1 T A 10: 52,154,927 E548D probably benign Het
Rsph10b G A 5: 143,985,465 R823Q probably benign Het
Scgb1b3 A G 7: 31,375,851 E42G probably damaging Het
Scyl2 T C 10: 89,652,996 N486D probably damaging Het
Sdr9c7 T A 10: 127,909,790 I257N possibly damaging Het
Serpinb9b A T 13: 33,039,904 I360F probably damaging Het
Slc15a5 T A 6: 138,055,706 I217F probably benign Het
Steap2 T C 5: 5,673,480 S467G probably benign Het
Tek C G 4: 94,820,102 P350R probably benign Het
Tet3 T C 6: 83,404,436 D250G probably damaging Het
Trip11 A G 12: 101,884,511 V1098A possibly damaging Het
Tsc2 G T 17: 24,626,717 T209K probably damaging Het
Ttc6 A G 12: 57,705,580 Y1424C probably damaging Het
Uchl3 A T 14: 101,666,550 K74N probably damaging Het
Usp10 T G 8: 119,941,165 S68R probably benign Het
Wwp1 T C 4: 19,650,282 I295V probably benign Het
Other mutations in Sycp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Sycp1 APN 3 102840962 missense probably benign
IGL00833:Sycp1 APN 3 102876301 critical splice donor site probably null
IGL01066:Sycp1 APN 3 102920634 missense probably damaging 1.00
IGL01484:Sycp1 APN 3 102915867 missense probably benign 0.01
IGL02139:Sycp1 APN 3 102865114 missense probably benign 0.00
IGL02270:Sycp1 APN 3 102895943 missense probably benign 0.12
IGL02347:Sycp1 APN 3 102893547 missense probably benign 0.00
IGL02630:Sycp1 APN 3 102878764 splice site probably benign
IGL02668:Sycp1 APN 3 102820531 splice site probably benign
IGL02928:Sycp1 APN 3 102818818 utr 3 prime probably benign
PIT4458001:Sycp1 UTSW 3 102934833 missense probably benign 0.01
R0027:Sycp1 UTSW 3 102895910 missense probably benign
R0282:Sycp1 UTSW 3 102915795 splice site probably benign
R0462:Sycp1 UTSW 3 102819106 missense possibly damaging 0.75
R0609:Sycp1 UTSW 3 102898849 splice site probably null
R0837:Sycp1 UTSW 3 102915245 missense probably benign 0.17
R1301:Sycp1 UTSW 3 102920622 missense probably benign 0.02
R2408:Sycp1 UTSW 3 102925259 missense probably damaging 1.00
R2449:Sycp1 UTSW 3 102925206 missense probably benign 0.15
R2516:Sycp1 UTSW 3 102845066 missense probably benign 0.09
R2880:Sycp1 UTSW 3 102818898 missense probably damaging 0.99
R3410:Sycp1 UTSW 3 102841041 missense possibly damaging 0.94
R3427:Sycp1 UTSW 3 102876350 missense probably benign 0.00
R4538:Sycp1 UTSW 3 102840962 missense probably benign
R4679:Sycp1 UTSW 3 102922462 critical splice acceptor site probably null
R4707:Sycp1 UTSW 3 102853489 missense possibly damaging 0.92
R4785:Sycp1 UTSW 3 102853489 missense possibly damaging 0.92
R5017:Sycp1 UTSW 3 102895987 splice site probably null
R5036:Sycp1 UTSW 3 102820600 missense probably damaging 1.00
R5044:Sycp1 UTSW 3 102845054 missense probably benign 0.03
R5070:Sycp1 UTSW 3 102920565 missense probably damaging 0.97
R5079:Sycp1 UTSW 3 102878800 missense possibly damaging 0.67
R5289:Sycp1 UTSW 3 102934253 missense possibly damaging 0.85
R5393:Sycp1 UTSW 3 102841047 splice site probably null
R5477:Sycp1 UTSW 3 102818890 missense probably damaging 1.00
R5576:Sycp1 UTSW 3 102818902 missense probably damaging 0.98
R5814:Sycp1 UTSW 3 102895897 missense probably benign 0.03
R6291:Sycp1 UTSW 3 102908961 missense probably damaging 1.00
R6460:Sycp1 UTSW 3 102925253 missense probably damaging 1.00
R6527:Sycp1 UTSW 3 102898887 missense probably benign 0.09
R6870:Sycp1 UTSW 3 102935603 missense probably damaging 1.00
R6873:Sycp1 UTSW 3 102840980 missense probably benign
R7037:Sycp1 UTSW 3 102898934 missense possibly damaging 0.62
R7210:Sycp1 UTSW 3 102853492 missense probably damaging 1.00
R7405:Sycp1 UTSW 3 102925227 missense possibly damaging 0.72
R7604:Sycp1 UTSW 3 102913433 missense probably damaging 0.98
R7733:Sycp1 UTSW 3 102895962 missense probably benign 0.00
R7858:Sycp1 UTSW 3 102898957 missense probably benign 0.09
R7909:Sycp1 UTSW 3 102820626 nonsense probably null
R8109:Sycp1 UTSW 3 102851602 missense probably benign 0.21
R8141:Sycp1 UTSW 3 102935569 missense possibly damaging 0.73
R8289:Sycp1 UTSW 3 102841037 missense probably benign 0.01
R8359:Sycp1 UTSW 3 102820593 missense probably damaging 0.98
R8844:Sycp1 UTSW 3 102865105 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTGAATCCAGAGTTTCTTCAAAGAA -3'
(R):5'- AGGTAGTTAACAGTCACATAAAGGT -3'

Sequencing Primer
(F):5'- ACTGGCTGCTCTTTCAGAGGAC -3'
(R):5'- GGACAATGAAACAAACTGGATAT -3'
Posted On2021-11-19