Incidental Mutation 'R9020:Klk1b27'
ID 686663
Institutional Source Beutler Lab
Gene Symbol Klk1b27
Ensembl Gene ENSMUSG00000063177
Gene Name kallikrein 1-related peptidase b27
Synonyms mGK-27, Klk27, Klk21l
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock # R9020 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 44052290-44056712 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 44055694 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 95 (V95D)
Ref Sequence ENSEMBL: ENSMUSP00000078786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079859]
AlphaFold Q9JM71
Predicted Effect probably damaging
Transcript: ENSMUST00000079859
AA Change: V95D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078786
Gene: ENSMUSG00000063177
AA Change: V95D

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Tryp_SPc 24 255 1.87e-97 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the kallikrein subfamily of serine proteases that are involved in diverse physiological functions such as skin desquamation, tooth enamel formation, seminal liquefaction, synaptic neural plasticity and brain function. The encoded preproprotein undergoes proteolytic cleavage of the activation peptide to generate the functional enzyme. This gene is located in a cluster of several related kallikrein genes on chromosome 7. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot11 A G 4: 106,748,418 S586P probably damaging Het
Adora3 T A 3: 105,907,825 I297N probably damaging Het
Adrb3 A T 8: 27,227,919 F167L probably damaging Het
Apob A G 12: 8,013,999 Y3955C probably damaging Het
Atp2a1 T C 7: 126,446,963 D963G probably benign Het
Btbd10 T C 7: 113,351,850 N11S possibly damaging Het
Casr A G 16: 36,495,249 S820P probably damaging Het
Ccdc82 C T 9: 13,281,425 R447C probably damaging Het
Cfap44 T A 16: 44,437,159 V1019E probably damaging Het
Cfap65 T C 1: 74,920,393 E866G probably damaging Het
Chd4 T A 6: 125,107,506 D713E probably damaging Het
Ctdsp1 T C 1: 74,395,517 F240S possibly damaging Het
Cyp26b1 C T 6: 84,575,074 V361I probably benign Het
Dmbt1 T A 7: 131,111,058 I1597N possibly damaging Het
Dnajc25 C A 4: 59,003,470 Y80* probably null Het
Fbxo17 A T 7: 28,737,357 N246Y possibly damaging Het
Filip1l A G 16: 57,570,695 T549A probably benign Het
Gm9758 A C 5: 14,914,725 N35K Het
Gtf2i T C 5: 134,246,561 T707A probably benign Het
Ifnk T C 4: 35,152,573 V167A probably damaging Het
Iqch T C 9: 63,525,244 M290V probably benign Het
Irx1 A T 13: 71,963,429 Y20* probably null Het
Jade2 T A 11: 51,817,627 Q572L probably benign Het
Kcne4 T A 1: 78,817,708 H24Q probably benign Het
Kcnt2 T A 1: 140,584,311 V1068E probably benign Het
Lins1 A G 7: 66,708,213 D32G probably damaging Het
Mavs A G 2: 131,246,674 E466G possibly damaging Het
Mipep T A 14: 60,831,228 L483* probably null Het
Muc16 G GAATGGCTTTCTT 9: 18,638,719 probably benign Het
Myo1a C A 10: 127,714,123 Q491K probably benign Het
Nle1 C G 11: 82,906,449 E146Q probably benign Het
Nphp3 T C 9: 104,031,951 Y787H probably benign Het
Pcdh15 A G 10: 74,645,611 S263G probably benign Het
Pcdhb8 T G 18: 37,356,784 I505S probably damaging Het
Phtf1 C G 3: 103,991,378 S339* probably null Het
Pip5k1b T A 19: 24,350,221 I424F probably benign Het
Plxna4 T A 6: 32,234,562 T681S possibly damaging Het
Prdm1 A G 10: 44,440,040 L700P probably damaging Het
Prtg C T 9: 72,891,995 T769I probably damaging Het
Rasgrf2 A G 13: 92,028,638 V340A possibly damaging Het
Ros1 T A 10: 52,154,927 E548D probably benign Het
Rsph10b G A 5: 143,985,465 R823Q probably benign Het
Scgb1b3 A G 7: 31,375,851 E42G probably damaging Het
Scyl2 T C 10: 89,652,996 N486D probably damaging Het
Sdr9c7 T A 10: 127,909,790 I257N possibly damaging Het
Serpinb9b A T 13: 33,039,904 I360F probably damaging Het
Slc15a5 T A 6: 138,055,706 I217F probably benign Het
Steap2 T C 5: 5,673,480 S467G probably benign Het
Sycp1 T C 3: 102,876,337 K607R probably benign Het
Tek C G 4: 94,820,102 P350R probably benign Het
Tet3 T C 6: 83,404,436 D250G probably damaging Het
Trip11 A G 12: 101,884,511 V1098A possibly damaging Het
Tsc2 G T 17: 24,626,717 T209K probably damaging Het
Ttc6 A G 12: 57,705,580 Y1424C probably damaging Het
Uchl3 A T 14: 101,666,550 K74N probably damaging Het
Usp10 T G 8: 119,941,165 S68R probably benign Het
Wwp1 T C 4: 19,650,282 I295V probably benign Het
Other mutations in Klk1b27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Klk1b27 APN 7 44056143 critical splice donor site probably null
IGL01328:Klk1b27 APN 7 44055879 missense probably damaging 1.00
IGL01552:Klk1b27 APN 7 44054615 missense probably damaging 1.00
IGL01632:Klk1b27 APN 7 44056673 utr 3 prime probably benign
R0574:Klk1b27 UTSW 7 44056101 missense probably damaging 1.00
R4723:Klk1b27 UTSW 7 44056532 missense probably damaging 1.00
R5800:Klk1b27 UTSW 7 44055664 missense probably benign 0.21
R6002:Klk1b27 UTSW 7 44055690 missense probably benign
R6244:Klk1b27 UTSW 7 44054550 missense probably benign 0.05
R6513:Klk1b27 UTSW 7 44055745 missense probably benign 0.00
R6584:Klk1b27 UTSW 7 44054511 missense possibly damaging 0.84
R6633:Klk1b27 UTSW 7 44055810 missense probably damaging 0.98
R7074:Klk1b27 UTSW 7 44056553 missense probably damaging 1.00
R7495:Klk1b27 UTSW 7 44056076 missense probably benign
R7830:Klk1b27 UTSW 7 44055726 missense probably benign 0.00
R8002:Klk1b27 UTSW 7 44056021 missense probably benign 0.01
R8969:Klk1b27 UTSW 7 44054508 missense probably damaging 0.99
R8994:Klk1b27 UTSW 7 44055712 missense probably damaging 1.00
R9104:Klk1b27 UTSW 7 44055886 nonsense probably null
X0024:Klk1b27 UTSW 7 44056593 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- AAGTTCAGCCCTGTCCTAGC -3'
(R):5'- CCACACCAAGCTGTATCCTTG -3'

Sequencing Primer
(F):5'- TGTCCTAGCTGCACCTGAG -3'
(R):5'- GCTGTATCCTTGGAGAAGACTCAC -3'
Posted On 2021-11-19