Mutagenetix > Incidental Mutations

Incidental Mutation 'R9020:Filip1l'

686693

Institutional Source

Beutler Lab

Gene Symbol

Filip1l

Ensembl Gene

ENSMUSG00000043336

Gene Name

filamin A interacting protein 1-like

Synonyms

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9020 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

57353093-57573126 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 57570695 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 549 (T549A)

Ref Sequence

ENSEMBL: ENSMUSP00000124179 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114371] [ENSMUST00000159414] [ENSMUST00000159816] [ENSMUST00000232413]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000114371

SMART Domains

Protein: ENSMUSP00000110011
Gene: ENSMUSG00000022748

Domain	Start	End	E-Value	Type
low complexity region	13	29	N/A	INTRINSIC
Pfam:CMS1	42	266	7.9e-35	PFAM
Pfam:DEAD	127	234	4e-7	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000159414
AA Change: T311A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000124069
Gene: ENSMUSG00000043336
AA Change: T311A

Domain	Start	End	E-Value	Type
coiled coil region	4	345	N/A	INTRINSIC
coiled coil region	371	542	N/A	INTRINSIC
low complexity region	589	602	N/A	INTRINSIC
low complexity region	868	879	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000159816
AA Change: T549A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000124179
Gene: ENSMUSG00000043336
AA Change: T549A

Domain	Start	End	E-Value	Type
Pfam:CortBP2	61	246	1.8e-65	PFAM
low complexity region	271	286	N/A	INTRINSIC
low complexity region	483	495	N/A	INTRINSIC
coiled coil region	609	780	N/A	INTRINSIC
low complexity region	827	840	N/A	INTRINSIC
low complexity region	1106	1117	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231282

Predicted Effect

probably benign
Transcript: ENSMUST00000232413

Meta Mutation Damage Score

0.0586

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acot11	A	G	4: 106,748,418	S586P	probably damaging	Het
Adora3	T	A	3: 105,907,825	I297N	probably damaging	Het
Adrb3	A	T	8: 27,227,919	F167L	probably damaging	Het
Apob	A	G	12: 8,013,999	Y3955C	probably damaging	Het
Atp2a1	T	C	7: 126,446,963	D963G	probably benign	Het
Btbd10	T	C	7: 113,351,850	N11S	possibly damaging	Het
Casr	A	G	16: 36,495,249	S820P	probably damaging	Het
Ccdc82	C	T	9: 13,281,425	R447C	probably damaging	Het
Cfap44	T	A	16: 44,437,159	V1019E	probably damaging	Het
Cfap65	T	C	1: 74,920,393	E866G	probably damaging	Het
Chd4	T	A	6: 125,107,506	D713E	probably damaging	Het
Ctdsp1	T	C	1: 74,395,517	F240S	possibly damaging	Het
Cyp26b1	C	T	6: 84,575,074	V361I	probably benign	Het
Dmbt1	T	A	7: 131,111,058	I1597N	possibly damaging	Het
Dnajc25	C	A	4: 59,003,470	Y80*	probably null	Het
Fbxo17	A	T	7: 28,737,357	N246Y	possibly damaging	Het
Gm9758	A	C	5: 14,914,725	N35K		Het
Gtf2i	T	C	5: 134,246,561	T707A	probably benign	Het
Ifnk	T	C	4: 35,152,573	V167A	probably damaging	Het
Iqch	T	C	9: 63,525,244	M290V	probably benign	Het
Irx1	A	T	13: 71,963,429	Y20*	probably null	Het
Jade2	T	A	11: 51,817,627	Q572L	probably benign	Het
Kcne4	T	A	1: 78,817,708	H24Q	probably benign	Het
Kcnt2	T	A	1: 140,584,311	V1068E	probably benign	Het
Klk1b27	T	A	7: 44,055,694	V95D	probably damaging	Het
Lins1	A	G	7: 66,708,213	D32G	probably damaging	Het
Mavs	A	G	2: 131,246,674	E466G	possibly damaging	Het
Mipep	T	A	14: 60,831,228	L483*	probably null	Het
Muc16	G	GAATGGCTTTCTT	9: 18,638,719		probably benign	Het
Myo1a	C	A	10: 127,714,123	Q491K	probably benign	Het
Nle1	C	G	11: 82,906,449	E146Q	probably benign	Het
Nphp3	T	C	9: 104,031,951	Y787H	probably benign	Het
Pcdh15	A	G	10: 74,645,611	S263G	probably benign	Het
Pcdhb8	T	G	18: 37,356,784	I505S	probably damaging	Het
Phtf1	C	G	3: 103,991,378	S339*	probably null	Het
Pip5k1b	T	A	19: 24,350,221	I424F	probably benign	Het
Plxna4	T	A	6: 32,234,562	T681S	possibly damaging	Het
Prdm1	A	G	10: 44,440,040	L700P	probably damaging	Het
Prtg	C	T	9: 72,891,995	T769I	probably damaging	Het
Rasgrf2	A	G	13: 92,028,638	V340A	possibly damaging	Het
Ros1	T	A	10: 52,154,927	E548D	probably benign	Het
Rsph10b	G	A	5: 143,985,465	R823Q	probably benign	Het
Scgb1b3	A	G	7: 31,375,851	E42G	probably damaging	Het
Scyl2	T	C	10: 89,652,996	N486D	probably damaging	Het
Sdr9c7	T	A	10: 127,909,790	I257N	possibly damaging	Het
Serpinb9b	A	T	13: 33,039,904	I360F	probably damaging	Het
Slc15a5	T	A	6: 138,055,706	I217F	probably benign	Het
Steap2	T	C	5: 5,673,480	S467G	probably benign	Het
Sycp1	T	C	3: 102,876,337	K607R	probably benign	Het
Tek	C	G	4: 94,820,102	P350R	probably benign	Het
Tet3	T	C	6: 83,404,436	D250G	probably damaging	Het
Trip11	A	G	12: 101,884,511	V1098A	possibly damaging	Het
Tsc2	G	T	17: 24,626,717	T209K	probably damaging	Het
Ttc6	A	G	12: 57,705,580	Y1424C	probably damaging	Het
Uchl3	A	T	14: 101,666,550	K74N	probably damaging	Het
Usp10	T	G	8: 119,941,165	S68R	probably benign	Het
Wwp1	T	C	4: 19,650,282	I295V	probably benign	Het

Other mutations in Filip1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01294:Filip1l	APN	16	57572348	nonsense	probably null
IGL01393:Filip1l	APN	16	57572223	missense	probably damaging	1.00
IGL01886:Filip1l	APN	16	57571250	missense	possibly damaging	0.47
IGL02336:Filip1l	APN	16	57571733	splice site	probably null
IGL02503:Filip1l	APN	16	57571575	missense	probably benign	0.00
IGL02608:Filip1l	APN	16	57572106	missense	probably benign	0.05
IGL02681:Filip1l	APN	16	57571779	missense	probably benign	0.10
IGL02687:Filip1l	APN	16	57571127	missense	probably benign	0.30
IGL02982:Filip1l	APN	16	57572232	missense	probably damaging	1.00
IGL03062:Filip1l	APN	16	57506804	missense	probably damaging	1.00
R1027:Filip1l	UTSW	16	57569688	missense	probably benign
R1347:Filip1l	UTSW	16	57570987	missense	probably damaging	1.00
R1347:Filip1l	UTSW	16	57570987	missense	probably damaging	1.00
R1384:Filip1l	UTSW	16	57571289	missense	possibly damaging	0.61
R1655:Filip1l	UTSW	16	57571851	missense	probably damaging	1.00
R1764:Filip1l	UTSW	16	57570038	missense	probably damaging	1.00
R1809:Filip1l	UTSW	16	57506660	missense	probably benign
R1983:Filip1l	UTSW	16	57571274	missense	probably damaging	0.98
R2504:Filip1l	UTSW	16	57570662	missense	possibly damaging	0.76
R2504:Filip1l	UTSW	16	57571047	missense	probably damaging	0.97
R3117:Filip1l	UTSW	16	57506732	missense	probably benign	0.07
R3844:Filip1l	UTSW	16	57572427	missense	probably benign	0.15
R3871:Filip1l	UTSW	16	57513286	missense	probably damaging	0.97
R4231:Filip1l	UTSW	16	57506768	missense	probably benign
R4391:Filip1l	UTSW	16	57570792	nonsense	probably null
R4700:Filip1l	UTSW	16	57570695	missense	probably benign	0.00
R4999:Filip1l	UTSW	16	57570415	missense	probably benign	0.01
R5002:Filip1l	UTSW	16	57571103	missense	probably benign	0.01
R5123:Filip1l	UTSW	16	57570662	missense	possibly damaging	0.76
R5294:Filip1l	UTSW	16	57570036	missense	possibly damaging	0.59
R5429:Filip1l	UTSW	16	57570255	missense	probably damaging	0.99
R5811:Filip1l	UTSW	16	57570294	missense	probably damaging	1.00
R6220:Filip1l	UTSW	16	57569989	missense	probably benign	0.31
R6452:Filip1l	UTSW	16	57506800	missense	possibly damaging	0.82
R6678:Filip1l	UTSW	16	57569970	missense	probably benign	0.00
R6700:Filip1l	UTSW	16	57571248	missense	possibly damaging	0.86
R7260:Filip1l	UTSW	16	57570924	missense	probably damaging	1.00
R7327:Filip1l	UTSW	16	57570937	missense	probably damaging	1.00
R7578:Filip1l	UTSW	16	57513282	missense	probably damaging	0.99
R7691:Filip1l	UTSW	16	57572433	missense	probably benign	0.00
R7950:Filip1l	UTSW	16	57569711	missense	probably damaging	1.00
R8288:Filip1l	UTSW	16	57570554	missense	probably damaging	1.00
R8334:Filip1l	UTSW	16	57570147	missense	probably benign	0.18
R8392:Filip1l	UTSW	16	57571353	missense	probably damaging	1.00
R8742:Filip1l	UTSW	16	57571230	missense	probably damaging	1.00
R9157:Filip1l	UTSW	16	57571617	missense	probably benign	0.04
RF019:Filip1l	UTSW	16	57570641	missense	probably benign	0.07
Z1088:Filip1l	UTSW	16	57513405	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAAGCCATTGAAAGTCGGCTAG -3'
(R):5'- GCTGTGGACTTACTGGAGTC -3'

Sequencing Primer
(F):5'- CCATTGAAAGTCGGCTAGAAAAGAC -3'
(R):5'- ACTTACTGGAGTCTTGGTTTAATTTG -3'

Posted On

2021-11-19