Incidental Mutation 'R9020:Filip1l'
ID 686693
Institutional Source Beutler Lab
Gene Symbol Filip1l
Ensembl Gene ENSMUSG00000043336
Gene Name filamin A interacting protein 1-like
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9020 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 57353093-57573126 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 57570695 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 549 (T549A)
Ref Sequence ENSEMBL: ENSMUSP00000124179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114371] [ENSMUST00000159414] [ENSMUST00000159816] [ENSMUST00000232413]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000114371
SMART Domains Protein: ENSMUSP00000110011
Gene: ENSMUSG00000022748

DomainStartEndE-ValueType
low complexity region 13 29 N/A INTRINSIC
Pfam:CMS1 42 266 7.9e-35 PFAM
Pfam:DEAD 127 234 4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159414
AA Change: T311A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000124069
Gene: ENSMUSG00000043336
AA Change: T311A

DomainStartEndE-ValueType
coiled coil region 4 345 N/A INTRINSIC
coiled coil region 371 542 N/A INTRINSIC
low complexity region 589 602 N/A INTRINSIC
low complexity region 868 879 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159816
AA Change: T549A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000124179
Gene: ENSMUSG00000043336
AA Change: T549A

DomainStartEndE-ValueType
Pfam:CortBP2 61 246 1.8e-65 PFAM
low complexity region 271 286 N/A INTRINSIC
low complexity region 483 495 N/A INTRINSIC
coiled coil region 609 780 N/A INTRINSIC
low complexity region 827 840 N/A INTRINSIC
low complexity region 1106 1117 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231282
Predicted Effect probably benign
Transcript: ENSMUST00000232413
Meta Mutation Damage Score 0.0586 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot11 A G 4: 106,748,418 S586P probably damaging Het
Adora3 T A 3: 105,907,825 I297N probably damaging Het
Adrb3 A T 8: 27,227,919 F167L probably damaging Het
Apob A G 12: 8,013,999 Y3955C probably damaging Het
Atp2a1 T C 7: 126,446,963 D963G probably benign Het
Btbd10 T C 7: 113,351,850 N11S possibly damaging Het
Casr A G 16: 36,495,249 S820P probably damaging Het
Ccdc82 C T 9: 13,281,425 R447C probably damaging Het
Cfap44 T A 16: 44,437,159 V1019E probably damaging Het
Cfap65 T C 1: 74,920,393 E866G probably damaging Het
Chd4 T A 6: 125,107,506 D713E probably damaging Het
Ctdsp1 T C 1: 74,395,517 F240S possibly damaging Het
Cyp26b1 C T 6: 84,575,074 V361I probably benign Het
Dmbt1 T A 7: 131,111,058 I1597N possibly damaging Het
Dnajc25 C A 4: 59,003,470 Y80* probably null Het
Fbxo17 A T 7: 28,737,357 N246Y possibly damaging Het
Gm9758 A C 5: 14,914,725 N35K Het
Gtf2i T C 5: 134,246,561 T707A probably benign Het
Ifnk T C 4: 35,152,573 V167A probably damaging Het
Iqch T C 9: 63,525,244 M290V probably benign Het
Irx1 A T 13: 71,963,429 Y20* probably null Het
Jade2 T A 11: 51,817,627 Q572L probably benign Het
Kcne4 T A 1: 78,817,708 H24Q probably benign Het
Kcnt2 T A 1: 140,584,311 V1068E probably benign Het
Klk1b27 T A 7: 44,055,694 V95D probably damaging Het
Lins1 A G 7: 66,708,213 D32G probably damaging Het
Mavs A G 2: 131,246,674 E466G possibly damaging Het
Mipep T A 14: 60,831,228 L483* probably null Het
Muc16 G GAATGGCTTTCTT 9: 18,638,719 probably benign Het
Myo1a C A 10: 127,714,123 Q491K probably benign Het
Nle1 C G 11: 82,906,449 E146Q probably benign Het
Nphp3 T C 9: 104,031,951 Y787H probably benign Het
Pcdh15 A G 10: 74,645,611 S263G probably benign Het
Pcdhb8 T G 18: 37,356,784 I505S probably damaging Het
Phtf1 C G 3: 103,991,378 S339* probably null Het
Pip5k1b T A 19: 24,350,221 I424F probably benign Het
Plxna4 T A 6: 32,234,562 T681S possibly damaging Het
Prdm1 A G 10: 44,440,040 L700P probably damaging Het
Prtg C T 9: 72,891,995 T769I probably damaging Het
Rasgrf2 A G 13: 92,028,638 V340A possibly damaging Het
Ros1 T A 10: 52,154,927 E548D probably benign Het
Rsph10b G A 5: 143,985,465 R823Q probably benign Het
Scgb1b3 A G 7: 31,375,851 E42G probably damaging Het
Scyl2 T C 10: 89,652,996 N486D probably damaging Het
Sdr9c7 T A 10: 127,909,790 I257N possibly damaging Het
Serpinb9b A T 13: 33,039,904 I360F probably damaging Het
Slc15a5 T A 6: 138,055,706 I217F probably benign Het
Steap2 T C 5: 5,673,480 S467G probably benign Het
Sycp1 T C 3: 102,876,337 K607R probably benign Het
Tek C G 4: 94,820,102 P350R probably benign Het
Tet3 T C 6: 83,404,436 D250G probably damaging Het
Trip11 A G 12: 101,884,511 V1098A possibly damaging Het
Tsc2 G T 17: 24,626,717 T209K probably damaging Het
Ttc6 A G 12: 57,705,580 Y1424C probably damaging Het
Uchl3 A T 14: 101,666,550 K74N probably damaging Het
Usp10 T G 8: 119,941,165 S68R probably benign Het
Wwp1 T C 4: 19,650,282 I295V probably benign Het
Other mutations in Filip1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01294:Filip1l APN 16 57572348 nonsense probably null
IGL01393:Filip1l APN 16 57572223 missense probably damaging 1.00
IGL01886:Filip1l APN 16 57571250 missense possibly damaging 0.47
IGL02336:Filip1l APN 16 57571733 splice site probably null
IGL02503:Filip1l APN 16 57571575 missense probably benign 0.00
IGL02608:Filip1l APN 16 57572106 missense probably benign 0.05
IGL02681:Filip1l APN 16 57571779 missense probably benign 0.10
IGL02687:Filip1l APN 16 57571127 missense probably benign 0.30
IGL02982:Filip1l APN 16 57572232 missense probably damaging 1.00
IGL03062:Filip1l APN 16 57506804 missense probably damaging 1.00
R1027:Filip1l UTSW 16 57569688 missense probably benign
R1347:Filip1l UTSW 16 57570987 missense probably damaging 1.00
R1347:Filip1l UTSW 16 57570987 missense probably damaging 1.00
R1384:Filip1l UTSW 16 57571289 missense possibly damaging 0.61
R1655:Filip1l UTSW 16 57571851 missense probably damaging 1.00
R1764:Filip1l UTSW 16 57570038 missense probably damaging 1.00
R1809:Filip1l UTSW 16 57506660 missense probably benign
R1983:Filip1l UTSW 16 57571274 missense probably damaging 0.98
R2504:Filip1l UTSW 16 57570662 missense possibly damaging 0.76
R2504:Filip1l UTSW 16 57571047 missense probably damaging 0.97
R3117:Filip1l UTSW 16 57506732 missense probably benign 0.07
R3844:Filip1l UTSW 16 57572427 missense probably benign 0.15
R3871:Filip1l UTSW 16 57513286 missense probably damaging 0.97
R4231:Filip1l UTSW 16 57506768 missense probably benign
R4391:Filip1l UTSW 16 57570792 nonsense probably null
R4700:Filip1l UTSW 16 57570695 missense probably benign 0.00
R4999:Filip1l UTSW 16 57570415 missense probably benign 0.01
R5002:Filip1l UTSW 16 57571103 missense probably benign 0.01
R5123:Filip1l UTSW 16 57570662 missense possibly damaging 0.76
R5294:Filip1l UTSW 16 57570036 missense possibly damaging 0.59
R5429:Filip1l UTSW 16 57570255 missense probably damaging 0.99
R5811:Filip1l UTSW 16 57570294 missense probably damaging 1.00
R6220:Filip1l UTSW 16 57569989 missense probably benign 0.31
R6452:Filip1l UTSW 16 57506800 missense possibly damaging 0.82
R6678:Filip1l UTSW 16 57569970 missense probably benign 0.00
R6700:Filip1l UTSW 16 57571248 missense possibly damaging 0.86
R7260:Filip1l UTSW 16 57570924 missense probably damaging 1.00
R7327:Filip1l UTSW 16 57570937 missense probably damaging 1.00
R7578:Filip1l UTSW 16 57513282 missense probably damaging 0.99
R7691:Filip1l UTSW 16 57572433 missense probably benign 0.00
R7950:Filip1l UTSW 16 57569711 missense probably damaging 1.00
R8288:Filip1l UTSW 16 57570554 missense probably damaging 1.00
R8334:Filip1l UTSW 16 57570147 missense probably benign 0.18
R8392:Filip1l UTSW 16 57571353 missense probably damaging 1.00
R8742:Filip1l UTSW 16 57571230 missense probably damaging 1.00
R9157:Filip1l UTSW 16 57571617 missense probably benign 0.04
RF019:Filip1l UTSW 16 57570641 missense probably benign 0.07
Z1088:Filip1l UTSW 16 57513405 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGCCATTGAAAGTCGGCTAG -3'
(R):5'- GCTGTGGACTTACTGGAGTC -3'

Sequencing Primer
(F):5'- CCATTGAAAGTCGGCTAGAAAAGAC -3'
(R):5'- ACTTACTGGAGTCTTGGTTTAATTTG -3'
Posted On 2021-11-19