Incidental Mutation 'R9026:1110002E22Rik'
ID 686715
Institutional Source Beutler Lab
Gene Symbol 1110002E22Rik
Ensembl Gene ENSMUSG00000090066
Gene Name RIKEN cDNA 1110002E22 gene
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.401) question?
Stock # R9026 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 138065052-138081506 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 138065148 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 33 (Q33K)
Ref Sequence ENSEMBL: ENSMUSP00000123851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053318] [ENSMUST00000163080]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000053318
Predicted Effect possibly damaging
Transcript: ENSMUST00000163080
AA Change: Q33K

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000123851
Gene: ENSMUSG00000090066
AA Change: Q33K

DomainStartEndE-ValueType
low complexity region 44 55 N/A INTRINSIC
low complexity region 87 102 N/A INTRINSIC
low complexity region 229 247 N/A INTRINSIC
low complexity region 422 438 N/A INTRINSIC
low complexity region 459 505 N/A INTRINSIC
low complexity region 667 680 N/A INTRINSIC
low complexity region 937 948 N/A INTRINSIC
low complexity region 995 1007 N/A INTRINSIC
low complexity region 1105 1115 N/A INTRINSIC
low complexity region 1224 1242 N/A INTRINSIC
low complexity region 1376 1385 N/A INTRINSIC
Pfam:DUF4585 1598 1667 6.9e-32 PFAM
low complexity region 1723 1738 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap2 A G 16: 31,107,088 L550P probably damaging Het
Acsm3 A T 7: 119,774,622 S244C probably benign Het
Adam28 T A 14: 68,609,144 D740V probably benign Het
Adcy4 C A 14: 55,778,969 V342L probably damaging Het
Adcyap1r1 A G 6: 55,481,122 T303A probably benign Het
Agr2 T C 12: 35,996,092 V74A probably benign Het
Akp3 A T 1: 87,127,064 T374S possibly damaging Het
Ankrd36 A T 11: 5,660,696 I1181L probably benign Het
Arhgap11a A T 2: 113,834,066 V624E probably benign Het
Arhgap30 A T 1: 171,400,690 D112V probably damaging Het
Atp8b4 A G 2: 126,342,963 F927L probably benign Het
Bend4 C A 5: 67,427,132 G150C unknown Het
Cd300lg T A 11: 102,054,172 S403T probably damaging Het
Cep57l1 T A 10: 41,731,090 Q159L probably damaging Het
Cipc C T 12: 86,952,860 T57M probably damaging Het
D3Ertd254e A G 3: 36,164,917 Y363C possibly damaging Het
Def8 T C 8: 123,459,652 C377R probably damaging Het
Dock1 A G 7: 135,119,017 D1285G probably damaging Het
Efcab10 A G 12: 33,398,399 D77G probably damaging Het
Eml4 C T 17: 83,457,050 T663M probably damaging Het
Ercc8 A G 13: 108,183,855 E325G possibly damaging Het
Ermap C A 4: 119,178,043 A583S probably damaging Het
F13a1 C T 13: 36,918,532 G406S probably null Het
Faap20 T A 4: 155,250,969 C141S probably benign Het
Fam193a A G 5: 34,459,192 T904A possibly damaging Het
Fam71d T C 12: 78,710,323 F18S probably benign Het
Gas8 A G 8: 123,533,395 D455G probably benign Het
Gm10334 A G 6: 41,446,056 F4L probably benign Het
Gm21863 T C 12: 19,954,520 S6P probably damaging Het
Gm4841 A T 18: 60,270,916 I35N probably damaging Het
Grk4 T A 5: 34,719,740 C260S probably damaging Het
Huwe1 G A X: 151,933,088 R4331Q unknown Het
Ighv5-6 A G 12: 113,625,627 Y78H probably benign Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kl T A 5: 150,953,026 S104T probably benign Het
Lyve1 C A 7: 110,853,975 C138F probably damaging Het
Med27 G A 2: 29,509,434 W92* probably null Het
Mrgpra4 C A 7: 47,981,460 R131L possibly damaging Het
Myf5 T C 10: 107,485,447 N162S probably benign Het
Myh15 G A 16: 49,187,070 E1835K probably damaging Het
Myo9a T A 9: 59,809,474 Y486N probably damaging Het
Ncapg T A 5: 45,695,773 N860K probably benign Het
Nr4a3 T C 4: 48,052,194 F316S possibly damaging Het
Nsd3 T A 8: 25,682,560 S778R probably benign Het
Olfr1132 A T 2: 87,635,025 C241S probably damaging Het
Olfr1158 A G 2: 87,990,224 T38A probably damaging Het
Olfr1183 A G 2: 88,461,852 I190V probably damaging Het
Olfr1224-ps1 A T 2: 89,156,644 V177E probably benign Het
Olfr456 A G 6: 42,486,861 F111L probably damaging Het
Olfr478 A G 7: 108,032,079 F88S probably damaging Het
Olfr866 T C 9: 20,027,048 N297D Het
Olfr884 T A 9: 38,047,589 Y122* probably null Het
Pdlim4 C T 11: 54,055,454 G231S probably benign Het
Pknox2 C T 9: 36,909,748 V273I possibly damaging Het
Pm20d1 A G 1: 131,812,084 H390R probably benign Het
Prkg2 A T 5: 98,966,527 D587E probably benign Het
Prps1l1 T A 12: 34,985,547 D220E possibly damaging Het
Ptchd3 T C 11: 121,830,856 V185A possibly damaging Het
Rag2 A T 2: 101,630,149 N268I possibly damaging Het
Rarres2 A G 6: 48,572,086 probably null Het
Rrp12 T C 19: 41,871,784 H1000R probably benign Het
S100a2 A T 3: 90,591,504 Y104F unknown Het
Sell A G 1: 164,065,473 Y86C probably damaging Het
Serpinb6d A T 13: 33,667,673 T138S possibly damaging Het
Slamf7 T A 1: 171,638,744 I228F probably benign Het
Slc11a1 G A 1: 74,377,166 V92M probably damaging Het
Spi1 A G 2: 91,082,517 N5S unknown Het
Stard9 G T 2: 120,705,802 D4151Y probably damaging Het
Stmnd1 A G 13: 46,299,507 T220A probably benign Het
Tacc2 G T 7: 130,623,536 W650C probably damaging Het
Tmc5 A G 7: 118,642,371 N429S possibly damaging Het
Tmem201 A C 4: 149,728,170 L230V probably benign Het
Tmem222 T C 4: 133,269,808 E94G possibly damaging Het
Trappc4 A G 9: 44,404,358 F186S probably damaging Het
Trim17 A G 11: 58,971,447 N435S probably benign Het
Trim68 A T 7: 102,680,240 L227Q probably damaging Het
Tuba3b T G 6: 145,618,270 V14G possibly damaging Het
Ubr2 G T 17: 46,934,115 H1662N probably damaging Het
Vps13c T A 9: 67,954,581 V2915E probably damaging Het
Vsig10 C T 5: 117,338,258 T259I probably benign Het
Other mutations in 1110002E22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0026:1110002E22Rik UTSW 3 138066805 missense possibly damaging 0.95
R0047:1110002E22Rik UTSW 3 138066264 missense probably damaging 0.97
R0047:1110002E22Rik UTSW 3 138066264 missense probably damaging 0.97
R0102:1110002E22Rik UTSW 3 138068113 missense probably damaging 1.00
R0102:1110002E22Rik UTSW 3 138068113 missense probably damaging 1.00
R0197:1110002E22Rik UTSW 3 138069871 missense probably damaging 1.00
R0239:1110002E22Rik UTSW 3 138065834 small deletion probably benign
R0394:1110002E22Rik UTSW 3 138067304 missense probably damaging 0.99
R0401:1110002E22Rik UTSW 3 138070306 missense possibly damaging 0.73
R0496:1110002E22Rik UTSW 3 138068244 missense probably damaging 1.00
R0591:1110002E22Rik UTSW 3 138068943 nonsense probably null
R0711:1110002E22Rik UTSW 3 138068225 missense probably damaging 0.99
R0883:1110002E22Rik UTSW 3 138069871 missense probably damaging 1.00
R0908:1110002E22Rik UTSW 3 138070077 missense probably damaging 0.99
R0968:1110002E22Rik UTSW 3 138067206 missense probably damaging 0.99
R1023:1110002E22Rik UTSW 3 138066871 missense probably damaging 1.00
R1168:1110002E22Rik UTSW 3 138067900 missense probably benign 0.20
R1472:1110002E22Rik UTSW 3 138067552 missense possibly damaging 0.95
R1538:1110002E22Rik UTSW 3 138065401 missense probably benign 0.02
R1648:1110002E22Rik UTSW 3 138069420 missense probably benign 0.18
R1800:1110002E22Rik UTSW 3 138066718 missense probably damaging 1.00
R1919:1110002E22Rik UTSW 3 138067270 missense probably damaging 0.99
R1974:1110002E22Rik UTSW 3 138067267 missense probably damaging 1.00
R1990:1110002E22Rik UTSW 3 138065658 nonsense probably null
R1991:1110002E22Rik UTSW 3 138065658 nonsense probably null
R2102:1110002E22Rik UTSW 3 138065173 missense probably damaging 0.99
R2761:1110002E22Rik UTSW 3 138067780 missense probably damaging 0.99
R2899:1110002E22Rik UTSW 3 138065682 missense probably benign 0.00
R3618:1110002E22Rik UTSW 3 138068407 missense probably damaging 1.00
R3904:1110002E22Rik UTSW 3 138066639 missense probably benign 0.15
R3955:1110002E22Rik UTSW 3 138068073 missense probably benign 0.00
R4520:1110002E22Rik UTSW 3 138070266 missense probably damaging 0.99
R4619:1110002E22Rik UTSW 3 138069759 missense probably damaging 0.99
R4736:1110002E22Rik UTSW 3 138068485 missense probably damaging 0.99
R4752:1110002E22Rik UTSW 3 138069990 missense possibly damaging 0.91
R4777:1110002E22Rik UTSW 3 138065742 missense probably benign 0.09
R4780:1110002E22Rik UTSW 3 138065370 missense probably benign 0.02
R4824:1110002E22Rik UTSW 3 138065676 missense probably benign 0.00
R4829:1110002E22Rik UTSW 3 138069019 missense probably damaging 0.99
R4965:1110002E22Rik UTSW 3 138069672 missense probably benign
R5206:1110002E22Rik UTSW 3 138066511 missense probably benign 0.00
R5212:1110002E22Rik UTSW 3 138065850 missense possibly damaging 0.85
R5373:1110002E22Rik UTSW 3 138067635 missense probably benign
R5374:1110002E22Rik UTSW 3 138067635 missense probably benign
R5506:1110002E22Rik UTSW 3 138067947 missense probably damaging 1.00
R5528:1110002E22Rik UTSW 3 138066499 missense probably benign
R5536:1110002E22Rik UTSW 3 138066388 missense possibly damaging 0.89
R5587:1110002E22Rik UTSW 3 138065409 missense probably benign
R5759:1110002E22Rik UTSW 3 138068658 missense probably benign
R5933:1110002E22Rik UTSW 3 138070348 missense probably damaging 1.00
R5957:1110002E22Rik UTSW 3 138070161 missense probably benign
R6092:1110002E22Rik UTSW 3 138068940 missense probably benign 0.02
R6305:1110002E22Rik UTSW 3 138067980 missense probably damaging 1.00
R6457:1110002E22Rik UTSW 3 138066622 missense probably damaging 1.00
R6469:1110002E22Rik UTSW 3 138066975 missense probably damaging 0.97
R6499:1110002E22Rik UTSW 3 138068800 missense probably damaging 1.00
R6527:1110002E22Rik UTSW 3 138067527 missense probably damaging 0.99
R6580:1110002E22Rik UTSW 3 138066625 missense probably benign 0.00
R6693:1110002E22Rik UTSW 3 138069154 missense probably benign 0.00
R6751:1110002E22Rik UTSW 3 138066210 missense probably damaging 1.00
R6852:1110002E22Rik UTSW 3 138065169 nonsense probably null
R6920:1110002E22Rik UTSW 3 138068050 missense probably damaging 1.00
R7001:1110002E22Rik UTSW 3 138065511 missense probably benign
R7145:1110002E22Rik UTSW 3 138070059 missense probably damaging 1.00
R7238:1110002E22Rik UTSW 3 138069951 missense probably damaging 1.00
R7278:1110002E22Rik UTSW 3 138065476 missense probably benign
R7425:1110002E22Rik UTSW 3 138065695 missense probably benign 0.00
R7487:1110002E22Rik UTSW 3 138066868 missense probably damaging 1.00
R7557:1110002E22Rik UTSW 3 138068283 nonsense probably null
R7663:1110002E22Rik UTSW 3 138066126 missense probably damaging 0.98
R7743:1110002E22Rik UTSW 3 138068755 missense probably damaging 1.00
R7799:1110002E22Rik UTSW 3 138069601 missense probably benign 0.33
R8181:1110002E22Rik UTSW 3 138068395 missense probably damaging 0.99
R8264:1110002E22Rik UTSW 3 138067782 missense probably damaging 0.99
R8273:1110002E22Rik UTSW 3 138066450 missense probably benign
R8434:1110002E22Rik UTSW 3 138067260 missense probably damaging 0.97
R8530:1110002E22Rik UTSW 3 138068825 missense probably damaging 0.99
R8754:1110002E22Rik UTSW 3 138066037 missense probably benign
R8808:1110002E22Rik UTSW 3 138070113 missense probably benign 0.01
R8891:1110002E22Rik UTSW 3 138066759 nonsense probably null
R9177:1110002E22Rik UTSW 3 138069916 missense probably damaging 1.00
R9250:1110002E22Rik UTSW 3 138066628 missense probably damaging 1.00
R9291:1110002E22Rik UTSW 3 138066703 missense probably benign 0.02
R9293:1110002E22Rik UTSW 3 138066078 missense possibly damaging 0.93
R9307:1110002E22Rik UTSW 3 138065422 missense probably benign 0.04
R9439:1110002E22Rik UTSW 3 138066287 missense probably benign 0.00
X0003:1110002E22Rik UTSW 3 138069096 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTCAAGTGTAGTTTCGATATGAC -3'
(R):5'- GTAGGTACCACTGCCACAGTTG -3'

Sequencing Primer
(F):5'- TTTCGATATGACTAGGGAATGGACAC -3'
(R):5'- CTGCCACAGTTGCCACC -3'
Posted On 2021-11-19