Incidental Mutation 'R9026:Trim68'
ID686734
Institutional Source Beutler Lab
Gene Symbol Trim68
Ensembl Gene ENSMUSG00000073968
Gene Nametripartite motif-containing 68
SynonymsRnf137, F730114J12Rik, SS-56
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R9026 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location102677582-102687327 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 102680240 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 227 (L227Q)
Ref Sequence ENSEMBL: ENSMUSP00000080813 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082175] [ENSMUST00000210855]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000082175
AA Change: L227Q

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000080813
Gene: ENSMUSG00000073968
AA Change: L227Q

DomainStartEndE-ValueType
RING 16 60 1.61e-8 SMART
BBOX 93 134 9.89e-9 SMART
coiled coil region 187 226 N/A INTRINSIC
PRY 302 354 1.91e-24 SMART
SPRY 355 482 3.03e-28 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000210855
AA Change: L227Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tripartite motif-containing protein family, whose members are characterized by a "really interesting new gene" (RING) finger domain, a zinc-binding B-box motif, and a coiled-coil region. Members of this family function as E3 ubiquitin ligases and are involved in a broad range of biological processes. This gene regulates the activation of nuclear receptors, such as androgen receptor, and has been implicated in development of prostate cancer cells, where its expression increases in response to a downregulation of microRNAs. In addition, this gene participates in viral defense regulation as a negative regulator of interferon-beta. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C A 3: 138,065,148 Q33K possibly damaging Het
Acap2 A G 16: 31,107,088 L550P probably damaging Het
Acsm3 A T 7: 119,774,622 S244C probably benign Het
Adam28 T A 14: 68,609,144 D740V probably benign Het
Adcy4 C A 14: 55,778,969 V342L probably damaging Het
Adcyap1r1 A G 6: 55,481,122 T303A probably benign Het
Agr2 T C 12: 35,996,092 V74A probably benign Het
Akp3 A T 1: 87,127,064 T374S possibly damaging Het
Ankrd36 A T 11: 5,660,696 I1181L probably benign Het
Arhgap11a A T 2: 113,834,066 V624E probably benign Het
Arhgap30 A T 1: 171,400,690 D112V probably damaging Het
Atp8b4 A G 2: 126,342,963 F927L probably benign Het
Bend4 C A 5: 67,427,132 G150C unknown Het
Cd300lg T A 11: 102,054,172 S403T probably damaging Het
Cep57l1 T A 10: 41,731,090 Q159L probably damaging Het
Cipc C T 12: 86,952,860 T57M probably damaging Het
D3Ertd254e A G 3: 36,164,917 Y363C possibly damaging Het
Def8 T C 8: 123,459,652 C377R probably damaging Het
Dock1 A G 7: 135,119,017 D1285G probably damaging Het
Efcab10 A G 12: 33,398,399 D77G probably damaging Het
Eml4 C T 17: 83,457,050 T663M probably damaging Het
Ercc8 A G 13: 108,183,855 E325G possibly damaging Het
Ermap C A 4: 119,178,043 A583S probably damaging Het
F13a1 C T 13: 36,918,532 G406S probably null Het
Faap20 T A 4: 155,250,969 C141S probably benign Het
Fam193a A G 5: 34,459,192 T904A possibly damaging Het
Fam71d T C 12: 78,710,323 F18S probably benign Het
Gas8 A G 8: 123,533,395 D455G probably benign Het
Gm10334 A G 6: 41,446,056 F4L probably benign Het
Gm21863 T C 12: 19,954,520 S6P probably damaging Het
Gm4841 A T 18: 60,270,916 I35N probably damaging Het
Grk4 T A 5: 34,719,740 C260S probably damaging Het
Huwe1 G A X: 151,933,088 R4331Q unknown Het
Ighv5-6 A G 12: 113,625,627 Y78H probably benign Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kl T A 5: 150,953,026 S104T probably benign Het
Lyve1 C A 7: 110,853,975 C138F probably damaging Het
Med27 G A 2: 29,509,434 W92* probably null Het
Mrgpra4 C A 7: 47,981,460 R131L possibly damaging Het
Myf5 T C 10: 107,485,447 N162S probably benign Het
Myh15 G A 16: 49,187,070 E1835K probably damaging Het
Myo9a T A 9: 59,809,474 Y486N probably damaging Het
Ncapg T A 5: 45,695,773 N860K probably benign Het
Nr4a3 T C 4: 48,052,194 F316S possibly damaging Het
Nsd3 T A 8: 25,682,560 S778R probably benign Het
Olfr1132 A T 2: 87,635,025 C241S probably damaging Het
Olfr1158 A G 2: 87,990,224 T38A probably damaging Het
Olfr1183 A G 2: 88,461,852 I190V probably damaging Het
Olfr1224-ps1 A T 2: 89,156,644 V177E probably benign Het
Olfr456 A G 6: 42,486,861 F111L probably damaging Het
Olfr478 A G 7: 108,032,079 F88S probably damaging Het
Olfr866 T C 9: 20,027,048 N297D Het
Olfr884 T A 9: 38,047,589 Y122* probably null Het
Pdlim4 C T 11: 54,055,454 G231S probably benign Het
Pknox2 C T 9: 36,909,748 V273I possibly damaging Het
Pm20d1 A G 1: 131,812,084 H390R probably benign Het
Prkg2 A T 5: 98,966,527 D587E probably benign Het
Prps1l1 T A 12: 34,985,547 D220E possibly damaging Het
Ptchd3 T C 11: 121,830,856 V185A possibly damaging Het
Rag2 A T 2: 101,630,149 N268I possibly damaging Het
Rarres2 A G 6: 48,572,086 probably null Het
Rrp12 T C 19: 41,871,784 H1000R probably benign Het
S100a2 A T 3: 90,591,504 Y104F unknown Het
Sell A G 1: 164,065,473 Y86C probably damaging Het
Serpinb6d A T 13: 33,667,673 T138S possibly damaging Het
Slamf7 T A 1: 171,638,744 I228F probably benign Het
Slc11a1 G A 1: 74,377,166 V92M probably damaging Het
Spi1 A G 2: 91,082,517 N5S unknown Het
Stard9 G T 2: 120,705,802 D4151Y probably damaging Het
Stmnd1 A G 13: 46,299,507 T220A probably benign Het
Tacc2 G T 7: 130,623,536 W650C probably damaging Het
Tmc5 A G 7: 118,642,371 N429S possibly damaging Het
Tmem201 A C 4: 149,728,170 L230V probably benign Het
Tmem222 T C 4: 133,269,808 E94G possibly damaging Het
Trappc4 A G 9: 44,404,358 F186S probably damaging Het
Trim17 A G 11: 58,971,447 N435S probably benign Het
Tuba3b T G 6: 145,618,270 V14G possibly damaging Het
Ubr2 G T 17: 46,934,115 H1662N probably damaging Het
Vps13c T A 9: 67,954,581 V2915E probably damaging Het
Vsig10 C T 5: 117,338,258 T259I probably benign Het
Other mutations in Trim68
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Trim68 APN 7 102679141 splice site probably null
IGL02703:Trim68 APN 7 102684079 missense probably damaging 0.99
IGL02835:Trim68 UTSW 7 102678573 missense probably benign 0.21
R1765:Trim68 UTSW 7 102680390 missense possibly damaging 0.82
R1780:Trim68 UTSW 7 102684073 missense possibly damaging 0.58
R4107:Trim68 UTSW 7 102678451 missense probably benign 0.01
R4451:Trim68 UTSW 7 102684473 start codon destroyed probably damaging 1.00
R5385:Trim68 UTSW 7 102678783 missense probably damaging 1.00
R5793:Trim68 UTSW 7 102684353 missense possibly damaging 0.74
R5980:Trim68 UTSW 7 102678831 missense probably damaging 1.00
R6749:Trim68 UTSW 7 102678783 missense probably damaging 0.99
R6912:Trim68 UTSW 7 102684468 missense probably damaging 1.00
R7396:Trim68 UTSW 7 102678362 nonsense probably null
R7789:Trim68 UTSW 7 102684469 missense possibly damaging 0.61
R7892:Trim68 UTSW 7 102678797 missense unknown
R8096:Trim68 UTSW 7 102678442 missense probably damaging 1.00
R8922:Trim68 UTSW 7 102678343 missense probably benign 0.03
R8986:Trim68 UTSW 7 102678601 nonsense probably null
X0067:Trim68 UTSW 7 102684132 missense probably benign 0.00
Z1176:Trim68 UTSW 7 102678813 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTAATACTTTCCCCTGGAGCC -3'
(R):5'- CATGTCAGTGTGCTCCATCC -3'

Sequencing Primer
(F):5'- GGAGCCTCCGTCTCCAGTTC -3'
(R):5'- AGACCAGTGCTAATTCCAGTCTTGAC -3'
Posted On2021-11-19