Incidental Mutation 'R9027:Alox12e'
ID 686814
Institutional Source Beutler Lab
Gene Symbol Alox12e
Ensembl Gene ENSMUSG00000018907
Gene Name arachidonate lipoxygenase, epidermal
Synonyms 8-LOX, Alox12-ps1, Alox12-ps2, Aloxe, e-LOX1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9027 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 70315610-70322628 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 70321774 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 83 (V83A)
Ref Sequence ENSEMBL: ENSMUSP00000019051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019051]
AlphaFold P55249
Predicted Effect possibly damaging
Transcript: ENSMUST00000019051
AA Change: V83A

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000019051
Gene: ENSMUSG00000018907
AA Change: V83A

DomainStartEndE-ValueType
LH2 2 111 9.49e-38 SMART
Pfam:Lipoxygenase 163 649 1.2e-60 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A T 19: 11,105,691 Y122N probably damaging Het
Adam1b C A 5: 121,502,725 E86* probably null Het
Ahnak T G 19: 9,007,253 I1967S possibly damaging Het
Arhgap20 A T 9: 51,843,677 R439S probably damaging Het
Arl1 A G 10: 88,733,596 I20V probably damaging Het
Atad2 T C 15: 58,132,232 D93G probably benign Het
Btbd7 T G 12: 102,838,579 K67N probably damaging Het
C130050O18Rik A G 5: 139,414,546 N118S probably benign Het
Ccz1 A C 5: 144,009,302 probably benign Het
Cdk19 A G 10: 40,479,732 S479G unknown Het
Chrd A G 16: 20,736,987 T503A probably damaging Het
Clca4b G A 3: 144,912,066 R759* probably null Het
Cpa5 G T 6: 30,612,605 M1I probably null Het
Cr2 A T 1: 195,151,721 I920N probably benign Het
Crmp1 C A 5: 37,280,603 Y430* probably null Het
Dars A T 1: 128,368,426 V390D possibly damaging Het
Dmtn A G 14: 70,616,115 S85P probably damaging Het
Fancm C A 12: 65,075,831 D42E probably damaging Het
Gabrg3 T A 7: 56,773,374 Y192F possibly damaging Het
Gm3435 A G 17: 15,022,102 E416G unknown Het
Gm8765 C T 13: 50,702,971 Q882* probably null Het
Gpr3 A T 4: 133,210,898 Y154* probably null Het
Huwe1 G A X: 151,933,088 R4331Q unknown Het
Ints5 C A 19: 8,895,958 P427Q possibly damaging Het
Jhy A T 9: 40,917,527 V361D probably benign Het
Klhl33 G A 14: 50,892,865 Q131* probably null Het
Lama2 A T 10: 27,204,885 C981S probably damaging Het
Mks1 C A 11: 87,857,215 L225I probably damaging Het
Nfasc T A 1: 132,611,605 S402C probably damaging Het
Olfr1300-ps1 A T 2: 111,692,172 Y218F unknown Het
Olfr47 T C 6: 43,236,424 I272T possibly damaging Het
Olfr577 T C 7: 102,973,353 D213G probably damaging Het
Pbx4 T A 8: 69,864,349 D85E possibly damaging Het
Plcd1 T C 9: 119,084,641 T50A probably damaging Het
Plk5 C G 10: 80,357,996 R40G probably damaging Het
Psen2 C A 1: 180,229,407 E351* probably null Het
Rragd G A 4: 32,996,083 V143I probably damaging Het
Rsph14 A T 10: 74,959,591 M254K probably damaging Het
Selenoi C T 5: 30,232,609 probably benign Het
Six6 T C 12: 72,940,161 S36P Het
Slc12a8 T C 16: 33,624,845 S370P probably benign Het
Slc25a46 A G 18: 31,583,379 Y357H probably benign Het
Socs2 A T 10: 95,413,086 V55D probably damaging Het
Socs6 T C 18: 88,870,728 E21G probably benign Het
Speg A T 1: 75,388,432 T486S possibly damaging Het
Spryd3 A G 15: 102,119,408 Y235H probably damaging Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 probably benign Het
Stxbp5l T C 16: 37,345,111 K82E probably damaging Het
Sugt1 A G 14: 79,587,715 probably benign Het
Synm T C 7: 67,734,692 Y1074C probably damaging Het
Sytl2 A G 7: 90,379,540 T476A probably benign Het
Tbc1d1 T C 5: 64,257,006 S237P probably benign Het
Tbc1d5 C A 17: 50,756,664 M629I probably damaging Het
Tlr11 G A 14: 50,361,292 G245D probably damaging Het
Tspan4 T C 7: 141,489,664 V59A probably benign Het
Tulp4 T A 17: 6,233,197 V1167E possibly damaging Het
Usp42 G A 5: 143,723,151 T204M probably damaging Het
Vapb A G 2: 173,776,155 K147R possibly damaging Het
Vmn1r228 T C 17: 20,777,160 D32G probably benign Het
Vmn2r33 A G 7: 7,551,169 F795S probably damaging Het
Vmn2r34 A T 7: 7,672,528 N620K probably damaging Het
Vwf G T 6: 125,666,663 C2389F Het
Wdr81 T C 11: 75,442,082 E652G Het
Wdr81 A T 11: 75,452,381 S687T probably benign Het
Zcrb1 A G 15: 93,387,575 probably null Het
Other mutations in Alox12e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00837:Alox12e APN 11 70321054 missense probably benign
IGL01781:Alox12e APN 11 70321456 missense probably damaging 1.00
R0284:Alox12e UTSW 11 70320899 splice site probably benign
R0417:Alox12e UTSW 11 70321865 missense probably benign 0.12
R0557:Alox12e UTSW 11 70321448 missense possibly damaging 0.80
R0593:Alox12e UTSW 11 70320897 splice site probably benign
R1479:Alox12e UTSW 11 70320782 missense probably benign 0.04
R1967:Alox12e UTSW 11 70317856 missense probably benign 0.18
R1996:Alox12e UTSW 11 70316208 missense probably benign 0.00
R2062:Alox12e UTSW 11 70316002 missense probably damaging 1.00
R2063:Alox12e UTSW 11 70316002 missense probably damaging 1.00
R2067:Alox12e UTSW 11 70316002 missense probably damaging 1.00
R2068:Alox12e UTSW 11 70316002 missense probably damaging 1.00
R2147:Alox12e UTSW 11 70319945 missense probably damaging 1.00
R2307:Alox12e UTSW 11 70321261 missense probably damaging 1.00
R3034:Alox12e UTSW 11 70316253 missense probably benign 0.01
R3739:Alox12e UTSW 11 70319842 missense probably damaging 1.00
R4463:Alox12e UTSW 11 70318256 missense probably damaging 1.00
R4572:Alox12e UTSW 11 70321181 intron probably benign
R5004:Alox12e UTSW 11 70321504 missense probably benign 0.00
R5113:Alox12e UTSW 11 70315995 missense possibly damaging 0.70
R5155:Alox12e UTSW 11 70316255 missense possibly damaging 0.61
R5464:Alox12e UTSW 11 70317679 missense probably damaging 0.99
R5471:Alox12e UTSW 11 70320024 missense probably benign 0.17
R5501:Alox12e UTSW 11 70316229 missense probably benign 0.01
R5915:Alox12e UTSW 11 70318224 missense possibly damaging 0.81
R6033:Alox12e UTSW 11 70316013 missense probably benign 0.03
R6033:Alox12e UTSW 11 70316013 missense probably benign 0.03
R6102:Alox12e UTSW 11 70320023 missense possibly damaging 0.65
R6380:Alox12e UTSW 11 70321101 missense probably benign 0.00
R6452:Alox12e UTSW 11 70320005 missense probably damaging 0.96
R7175:Alox12e UTSW 11 70319708 missense probably damaging 1.00
R7220:Alox12e UTSW 11 70315905 missense probably benign 0.02
R7353:Alox12e UTSW 11 70321435 missense probably damaging 1.00
R7542:Alox12e UTSW 11 70321756 missense possibly damaging 0.69
R7916:Alox12e UTSW 11 70321285 missense probably benign
R8314:Alox12e UTSW 11 70316172 missense possibly damaging 0.83
R8331:Alox12e UTSW 11 70321097 missense probably benign 0.01
R9380:Alox12e UTSW 11 70316168 critical splice donor site probably null
R9641:Alox12e UTSW 11 70321435 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGTGTGTCCTCTTAGGGC -3'
(R):5'- CAATTGGAGCCAAAGCCAAG -3'

Sequencing Primer
(F):5'- CACCGCTCTGTGCCCTC -3'
(R):5'- AAGCCAAGCTTCTCCGAGG -3'
Posted On 2021-11-19