Incidental Mutation 'R9027:Btbd7'
ID 686820
Institutional Source Beutler Lab
Gene Symbol Btbd7
Ensembl Gene ENSMUSG00000041702
Gene Name BTB (POZ) domain containing 7
Synonyms FUP1, E130118E17Rik, 5730507E09Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.336) question?
Stock # R9027 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 102780797-102878471 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 102838579 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 67 (K67N)
Ref Sequence ENSEMBL: ENSMUSP00000046951 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045652] [ENSMUST00000223554]
AlphaFold Q8CFE5
Predicted Effect probably damaging
Transcript: ENSMUST00000045652
AA Change: K67N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000046951
Gene: ENSMUSG00000041702
AA Change: K67N

DomainStartEndE-ValueType
BTB 142 244 1.57e-13 SMART
BTB 247 397 2.23e-4 SMART
BACK 402 538 1.49e-4 SMART
low complexity region 626 640 N/A INTRINSIC
low complexity region 756 771 N/A INTRINSIC
low complexity region 783 792 N/A INTRINSIC
low complexity region 808 822 N/A INTRINSIC
low complexity region 839 850 N/A INTRINSIC
low complexity region 1076 1088 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000223554
AA Change: K67N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A T 19: 11,105,691 Y122N probably damaging Het
Adam1b C A 5: 121,502,725 E86* probably null Het
Ahnak T G 19: 9,007,253 I1967S possibly damaging Het
Alox12e A G 11: 70,321,774 V83A possibly damaging Het
Arhgap20 A T 9: 51,843,677 R439S probably damaging Het
Arl1 A G 10: 88,733,596 I20V probably damaging Het
Atad2 T C 15: 58,132,232 D93G probably benign Het
C130050O18Rik A G 5: 139,414,546 N118S probably benign Het
Cdk19 A G 10: 40,479,732 S479G unknown Het
Chrd A G 16: 20,736,987 T503A probably damaging Het
Clca4b G A 3: 144,912,066 R759* probably null Het
Cpa5 G T 6: 30,612,605 M1I probably null Het
Cr2 A T 1: 195,151,721 I920N probably benign Het
Crmp1 C A 5: 37,280,603 Y430* probably null Het
Dars A T 1: 128,368,426 V390D possibly damaging Het
Dmtn A G 14: 70,616,115 S85P probably damaging Het
Fancm C A 12: 65,075,831 D42E probably damaging Het
Gabrg3 T A 7: 56,773,374 Y192F possibly damaging Het
Gm3435 A G 17: 15,022,102 E416G unknown Het
Gm8765 C T 13: 50,702,971 Q882* probably null Het
Gpr3 A T 4: 133,210,898 Y154* probably null Het
Huwe1 G A X: 151,933,088 R4331Q unknown Het
Ints5 C A 19: 8,895,958 P427Q possibly damaging Het
Jhy A T 9: 40,917,527 V361D probably benign Het
Klhl33 G A 14: 50,892,865 Q131* probably null Het
Lama2 A T 10: 27,204,885 C981S probably damaging Het
Mks1 C A 11: 87,857,215 L225I probably damaging Het
Nfasc T A 1: 132,611,605 S402C probably damaging Het
Olfr1300-ps1 A T 2: 111,692,172 Y218F unknown Het
Olfr47 T C 6: 43,236,424 I272T possibly damaging Het
Olfr577 T C 7: 102,973,353 D213G probably damaging Het
Pbx4 T A 8: 69,864,349 D85E possibly damaging Het
Plcd1 T C 9: 119,084,641 T50A probably damaging Het
Plk5 C G 10: 80,357,996 R40G probably damaging Het
Psen2 C A 1: 180,229,407 E351* probably null Het
Rragd G A 4: 32,996,083 V143I probably damaging Het
Rsph14 A T 10: 74,959,591 M254K probably damaging Het
Selenoi C T 5: 30,232,609 probably benign Het
Six6 T C 12: 72,940,161 S36P Het
Slc12a8 T C 16: 33,624,845 S370P probably benign Het
Slc25a46 A G 18: 31,583,379 Y357H probably benign Het
Socs2 A T 10: 95,413,086 V55D probably damaging Het
Socs6 T C 18: 88,870,728 E21G probably benign Het
Speg A T 1: 75,388,432 T486S possibly damaging Het
Spryd3 A G 15: 102,119,408 Y235H probably damaging Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 probably benign Het
Stxbp5l T C 16: 37,345,111 K82E probably damaging Het
Sugt1 A G 14: 79,587,715 probably benign Het
Synm T C 7: 67,734,692 Y1074C probably damaging Het
Sytl2 A G 7: 90,379,540 T476A probably benign Het
Tbc1d1 T C 5: 64,257,006 S237P probably benign Het
Tbc1d5 C A 17: 50,756,664 M629I probably damaging Het
Tlr11 G A 14: 50,361,292 G245D probably damaging Het
Tspan4 T C 7: 141,489,664 V59A probably benign Het
Tulp4 T A 17: 6,233,197 V1167E possibly damaging Het
Usp42 G A 5: 143,723,151 T204M probably damaging Het
Vapb A G 2: 173,776,155 K147R possibly damaging Het
Vmn1r228 T C 17: 20,777,160 D32G probably benign Het
Vmn2r33 A G 7: 7,551,169 F795S probably damaging Het
Vmn2r34 A T 7: 7,672,528 N620K probably damaging Het
Vwf G T 6: 125,666,663 C2389F Het
Wdr81 T C 11: 75,442,082 E652G Het
Wdr81 A T 11: 75,452,381 S687T probably benign Het
Zcrb1 A G 15: 93,387,575 probably null Het
Other mutations in Btbd7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02047:Btbd7 APN 12 102793779 missense probably benign 0.10
IGL02899:Btbd7 APN 12 102837662 missense probably damaging 1.00
IGL03204:Btbd7 APN 12 102807980 nonsense probably null
H8562:Btbd7 UTSW 12 102788302 missense probably benign 0.26
IGL03050:Btbd7 UTSW 12 102812806 missense probably benign 0.03
R1262:Btbd7 UTSW 12 102787951 missense probably benign
R1423:Btbd7 UTSW 12 102785475 missense possibly damaging 0.49
R1437:Btbd7 UTSW 12 102788090 missense possibly damaging 0.59
R1636:Btbd7 UTSW 12 102793851 missense probably damaging 1.00
R1641:Btbd7 UTSW 12 102790775 missense probably damaging 1.00
R1722:Btbd7 UTSW 12 102812654 missense possibly damaging 0.96
R1921:Btbd7 UTSW 12 102793796 missense probably benign 0.01
R2021:Btbd7 UTSW 12 102790709 missense probably damaging 1.00
R2180:Btbd7 UTSW 12 102785897 missense probably damaging 1.00
R3768:Btbd7 UTSW 12 102795192 missense probably damaging 1.00
R3770:Btbd7 UTSW 12 102795192 missense probably damaging 1.00
R3786:Btbd7 UTSW 12 102838152 missense probably benign 0.22
R4396:Btbd7 UTSW 12 102785293 missense probably benign 0.00
R4809:Btbd7 UTSW 12 102793744 critical splice donor site probably null
R4910:Btbd7 UTSW 12 102808048 missense probably damaging 0.98
R4915:Btbd7 UTSW 12 102837787 nonsense probably null
R5054:Btbd7 UTSW 12 102838212 missense probably benign 0.02
R5276:Btbd7 UTSW 12 102838392 missense probably benign 0.00
R5387:Btbd7 UTSW 12 102837785 missense probably damaging 0.99
R5665:Btbd7 UTSW 12 102785197 missense probably benign
R7083:Btbd7 UTSW 12 102788335 missense probably damaging 0.99
R7354:Btbd7 UTSW 12 102838205 missense probably benign 0.05
R7429:Btbd7 UTSW 12 102837780 missense probably damaging 1.00
R7462:Btbd7 UTSW 12 102837722 missense possibly damaging 0.88
R7469:Btbd7 UTSW 12 102812768 missense probably damaging 0.99
R7998:Btbd7 UTSW 12 102795240 missense probably damaging 1.00
R8499:Btbd7 UTSW 12 102788372 missense probably damaging 1.00
R8773:Btbd7 UTSW 12 102837982 missense probably benign 0.02
R8783:Btbd7 UTSW 12 102788242 missense probably benign 0.45
R8968:Btbd7 UTSW 12 102812766 missense probably damaging 1.00
R9016:Btbd7 UTSW 12 102785158 missense probably damaging 1.00
R9216:Btbd7 UTSW 12 102795304 missense probably damaging 1.00
R9221:Btbd7 UTSW 12 102811171 missense probably damaging 1.00
X0024:Btbd7 UTSW 12 102812686 nonsense probably null
X0025:Btbd7 UTSW 12 102811164 missense probably benign 0.06
Z1177:Btbd7 UTSW 12 102811120 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTCATAAAGGTCGGCCATG -3'
(R):5'- CACACACCTACATTTATTTGAGCTC -3'

Sequencing Primer
(F):5'- ATAAAGGTCGGCCATGTCCTTCTG -3'
(R):5'- AGCCTCAGCCTCTAAATGGTAGG -3'
Posted On 2021-11-19