Incidental Mutation 'R9027:Vmn1r228'
ID 686834
Institutional Source Beutler Lab
Gene Symbol Vmn1r228
Ensembl Gene ENSMUSG00000060245
Gene Name vomeronasal 1 receptor 228
Synonyms V1re3
MMRRC Submission 068856-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.063) question?
Stock # R9027 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 20996321-20997763 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 20997422 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 32 (D32G)
Ref Sequence ENSEMBL: ENSMUSP00000072243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072410]
AlphaFold Q8R2A7
Predicted Effect probably benign
Transcript: ENSMUST00000072410
AA Change: D32G

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000072243
Gene: ENSMUSG00000060245
AA Change: D32G

DomainStartEndE-ValueType
Pfam:TAS2R 32 317 2.6e-11 PFAM
Pfam:7tm_1 53 316 2.6e-9 PFAM
Pfam:V1R 63 321 1.3e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam1b C A 5: 121,640,788 (GRCm39) E86* probably null Het
Ahnak T G 19: 8,984,617 (GRCm39) I1967S possibly damaging Het
Alox12e A G 11: 70,212,600 (GRCm39) V83A possibly damaging Het
Arhgap20 A T 9: 51,754,977 (GRCm39) R439S probably damaging Het
Arl1 A G 10: 88,569,458 (GRCm39) I20V probably damaging Het
Atad2 T C 15: 57,995,628 (GRCm39) D93G probably benign Het
Btbd7 T G 12: 102,804,838 (GRCm39) K67N probably damaging Het
C130050O18Rik A G 5: 139,400,301 (GRCm39) N118S probably benign Het
Ccz1 A C 5: 143,946,120 (GRCm39) probably benign Het
Cdk19 A G 10: 40,355,728 (GRCm39) S479G unknown Het
Chrd A G 16: 20,555,737 (GRCm39) T503A probably damaging Het
Clca4b G A 3: 144,617,827 (GRCm39) R759* probably null Het
Cpa5 G T 6: 30,612,604 (GRCm39) M1I probably null Het
Cr2 A T 1: 194,834,029 (GRCm39) I920N probably benign Het
Crmp1 C A 5: 37,437,947 (GRCm39) Y430* probably null Het
Dars1 A T 1: 128,296,163 (GRCm39) V390D possibly damaging Het
Dmtn A G 14: 70,853,555 (GRCm39) S85P probably damaging Het
Ermardl1 A G 17: 15,242,364 (GRCm39) E416G unknown Het
Fancm C A 12: 65,122,605 (GRCm39) D42E probably damaging Het
Gabrg3 T A 7: 56,423,122 (GRCm39) Y192F possibly damaging Het
Gpr3 A T 4: 132,938,209 (GRCm39) Y154* probably null Het
Huwe1 G A X: 150,716,084 (GRCm39) R4331Q unknown Het
Ints5 C A 19: 8,873,322 (GRCm39) P427Q possibly damaging Het
Jhy A T 9: 40,828,823 (GRCm39) V361D probably benign Het
Klhl33 G A 14: 51,130,322 (GRCm39) Q131* probably null Het
Lama2 A T 10: 27,080,881 (GRCm39) C981S probably damaging Het
Mks1 C A 11: 87,748,041 (GRCm39) L225I probably damaging Het
Ms4a20 A T 19: 11,083,055 (GRCm39) Y122N probably damaging Het
Nfasc T A 1: 132,539,343 (GRCm39) S402C probably damaging Het
Or2a57 T C 6: 43,213,358 (GRCm39) I272T possibly damaging Het
Or4k50-ps1 A T 2: 111,522,517 (GRCm39) Y218F unknown Het
Or51g2 T C 7: 102,622,560 (GRCm39) D213G probably damaging Het
Pbx4 T A 8: 70,316,999 (GRCm39) D85E possibly damaging Het
Plcd1 T C 9: 118,913,709 (GRCm39) T50A probably damaging Het
Plk5 C G 10: 80,193,830 (GRCm39) R40G probably damaging Het
Psen2 C A 1: 180,056,972 (GRCm39) E351* probably null Het
Rragd G A 4: 32,996,083 (GRCm39) V143I probably damaging Het
Rsph14 A T 10: 74,795,423 (GRCm39) M254K probably damaging Het
Selenoi C T 5: 30,437,607 (GRCm39) probably benign Het
Six6 T C 12: 72,986,935 (GRCm39) S36P Het
Slc12a8 T C 16: 33,445,215 (GRCm39) S370P probably benign Het
Slc25a46 A G 18: 31,716,432 (GRCm39) Y357H probably benign Het
Socs2 A T 10: 95,248,948 (GRCm39) V55D probably damaging Het
Socs6 T C 18: 88,888,852 (GRCm39) E21G probably benign Het
Spata31e4 C T 13: 50,857,007 (GRCm39) Q882* probably null Het
Speg A T 1: 75,365,076 (GRCm39) T486S possibly damaging Het
Spryd3 A G 15: 102,027,843 (GRCm39) Y235H probably damaging Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 (GRCm39) probably benign Het
Stxbp5l T C 16: 37,165,473 (GRCm39) K82E probably damaging Het
Sugt1 A G 14: 79,825,155 (GRCm39) probably benign Het
Synm T C 7: 67,384,440 (GRCm39) Y1074C probably damaging Het
Sytl2 A G 7: 90,028,748 (GRCm39) T476A probably benign Het
Tbc1d1 T C 5: 64,414,349 (GRCm39) S237P probably benign Het
Tbc1d5 C A 17: 51,063,692 (GRCm39) M629I probably damaging Het
Tlr11 G A 14: 50,598,749 (GRCm39) G245D probably damaging Het
Tspan4 T C 7: 141,069,577 (GRCm39) V59A probably benign Het
Tulp4 T A 17: 6,283,472 (GRCm39) V1167E possibly damaging Het
Usp42 G A 5: 143,708,906 (GRCm39) T204M probably damaging Het
Vapb A G 2: 173,617,948 (GRCm39) K147R possibly damaging Het
Vmn2r33 A G 7: 7,554,168 (GRCm39) F795S probably damaging Het
Vmn2r34 A T 7: 7,675,527 (GRCm39) N620K probably damaging Het
Vwf G T 6: 125,643,626 (GRCm39) C2389F Het
Wdr81 T C 11: 75,332,908 (GRCm39) E652G Het
Wdr81 A T 11: 75,343,207 (GRCm39) S687T probably benign Het
Zcrb1 A G 15: 93,285,456 (GRCm39) probably null Het
Other mutations in Vmn1r228
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01368:Vmn1r228 APN 17 20,996,774 (GRCm39) missense probably benign 0.07
IGL03275:Vmn1r228 APN 17 20,997,104 (GRCm39) missense probably damaging 1.00
PIT4498001:Vmn1r228 UTSW 17 20,996,772 (GRCm39) missense probably benign 0.00
R0097:Vmn1r228 UTSW 17 20,996,625 (GRCm39) missense probably benign 0.05
R0097:Vmn1r228 UTSW 17 20,996,625 (GRCm39) missense probably benign 0.05
R0270:Vmn1r228 UTSW 17 20,996,858 (GRCm39) missense possibly damaging 0.60
R0279:Vmn1r228 UTSW 17 20,996,637 (GRCm39) missense probably benign 0.02
R1544:Vmn1r228 UTSW 17 20,997,285 (GRCm39) missense probably benign 0.00
R1695:Vmn1r228 UTSW 17 20,996,560 (GRCm39) missense possibly damaging 0.49
R2086:Vmn1r228 UTSW 17 20,997,455 (GRCm39) missense possibly damaging 0.71
R2275:Vmn1r228 UTSW 17 20,996,807 (GRCm39) missense probably damaging 1.00
R2965:Vmn1r228 UTSW 17 20,996,609 (GRCm39) missense probably damaging 0.99
R4425:Vmn1r228 UTSW 17 20,996,861 (GRCm39) missense probably damaging 1.00
R4447:Vmn1r228 UTSW 17 20,997,369 (GRCm39) missense probably damaging 0.96
R5031:Vmn1r228 UTSW 17 20,996,943 (GRCm39) nonsense probably null
R6345:Vmn1r228 UTSW 17 20,997,144 (GRCm39) missense probably damaging 1.00
R7064:Vmn1r228 UTSW 17 20,997,285 (GRCm39) missense probably benign 0.00
R7880:Vmn1r228 UTSW 17 20,996,672 (GRCm39) missense probably damaging 1.00
R8000:Vmn1r228 UTSW 17 20,997,227 (GRCm39) missense possibly damaging 0.88
R8290:Vmn1r228 UTSW 17 20,996,724 (GRCm39) missense probably benign 0.09
R9022:Vmn1r228 UTSW 17 20,996,778 (GRCm39) missense probably damaging 1.00
R9291:Vmn1r228 UTSW 17 20,997,023 (GRCm39) missense probably benign
R9492:Vmn1r228 UTSW 17 20,996,862 (GRCm39) missense probably damaging 1.00
R9618:Vmn1r228 UTSW 17 20,997,045 (GRCm39) missense probably benign 0.00
X0018:Vmn1r228 UTSW 17 20,996,963 (GRCm39) missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GGGTCCTTTGGAGAGAAGGATC -3'
(R):5'- ACATGTGCACTCAGACTTTGAAAG -3'

Sequencing Primer
(F):5'- TCAAGGCGTTGGATGTAAACAC -3'
(R):5'- GCACTCAGACTTTGAAAGTTTCATGG -3'
Posted On 2021-11-19