Incidental Mutation 'R9027:Sry'
ID 686842
Institutional Source Beutler Lab
Gene Symbol Sry
Ensembl Gene ENSMUSG00000069036
Gene Name sex determining region of Chr Y
Synonyms Tdy, Tdf
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.318) question?
Stock # R9027 (G1)
Quality Score 166.457
Status Not validated
Chromosome Y
Chromosomal Location 2662471-2663658 bp(-) (GRCm38)
Type of Mutation small deletion (10 aa in frame mutation)
DNA Base Change (assembly) GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG to GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG at 2662638 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000088717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091178]
AlphaFold Q05738
Predicted Effect probably benign
Transcript: ENSMUST00000091178
SMART Domains Protein: ENSMUSP00000088717
Gene: ENSMUSG00000069036

DomainStartEndE-ValueType
HMG 4 74 2.76e-24 SMART
low complexity region 144 366 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Variations in expression of alleles on specific backgrounds result in partial and/or complete male to female sex reversal. Deletion of alleles results in XY females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A T 19: 11,105,691 Y122N probably damaging Het
Adam1b C A 5: 121,502,725 E86* probably null Het
Ahnak T G 19: 9,007,253 I1967S possibly damaging Het
Alox12e A G 11: 70,321,774 V83A possibly damaging Het
Arhgap20 A T 9: 51,843,677 R439S probably damaging Het
Arl1 A G 10: 88,733,596 I20V probably damaging Het
Atad2 T C 15: 58,132,232 D93G probably benign Het
Btbd7 T G 12: 102,838,579 K67N probably damaging Het
C130050O18Rik A G 5: 139,414,546 N118S probably benign Het
Cdk19 A G 10: 40,479,732 S479G unknown Het
Chrd A G 16: 20,736,987 T503A probably damaging Het
Clca4b G A 3: 144,912,066 R759* probably null Het
Cpa5 G T 6: 30,612,605 M1I probably null Het
Cr2 A T 1: 195,151,721 I920N probably benign Het
Crmp1 C A 5: 37,280,603 Y430* probably null Het
Dars A T 1: 128,368,426 V390D possibly damaging Het
Dmtn A G 14: 70,616,115 S85P probably damaging Het
Fancm C A 12: 65,075,831 D42E probably damaging Het
Gabrg3 T A 7: 56,773,374 Y192F possibly damaging Het
Gm3435 A G 17: 15,022,102 E416G unknown Het
Gm8765 C T 13: 50,702,971 Q882* probably null Het
Gpr3 A T 4: 133,210,898 Y154* probably null Het
Huwe1 G A X: 151,933,088 R4331Q unknown Het
Ints5 C A 19: 8,895,958 P427Q possibly damaging Het
Jhy A T 9: 40,917,527 V361D probably benign Het
Klhl33 G A 14: 50,892,865 Q131* probably null Het
Lama2 A T 10: 27,204,885 C981S probably damaging Het
Mks1 C A 11: 87,857,215 L225I probably damaging Het
Nfasc T A 1: 132,611,605 S402C probably damaging Het
Olfr1300-ps1 A T 2: 111,692,172 Y218F unknown Het
Olfr47 T C 6: 43,236,424 I272T possibly damaging Het
Olfr577 T C 7: 102,973,353 D213G probably damaging Het
Pbx4 T A 8: 69,864,349 D85E possibly damaging Het
Plcd1 T C 9: 119,084,641 T50A probably damaging Het
Plk5 C G 10: 80,357,996 R40G probably damaging Het
Psen2 C A 1: 180,229,407 E351* probably null Het
Rragd G A 4: 32,996,083 V143I probably damaging Het
Rsph14 A T 10: 74,959,591 M254K probably damaging Het
Selenoi C T 5: 30,232,609 probably benign Het
Six6 T C 12: 72,940,161 S36P Het
Slc12a8 T C 16: 33,624,845 S370P probably benign Het
Slc25a46 A G 18: 31,583,379 Y357H probably benign Het
Socs2 A T 10: 95,413,086 V55D probably damaging Het
Socs6 T C 18: 88,870,728 E21G probably benign Het
Speg A T 1: 75,388,432 T486S possibly damaging Het
Spryd3 A G 15: 102,119,408 Y235H probably damaging Het
Stxbp5l T C 16: 37,345,111 K82E probably damaging Het
Sugt1 A G 14: 79,587,715 probably benign Het
Synm T C 7: 67,734,692 Y1074C probably damaging Het
Sytl2 A G 7: 90,379,540 T476A probably benign Het
Tbc1d1 T C 5: 64,257,006 S237P probably benign Het
Tbc1d5 C A 17: 50,756,664 M629I probably damaging Het
Tlr11 G A 14: 50,361,292 G245D probably damaging Het
Tspan4 T C 7: 141,489,664 V59A probably benign Het
Tulp4 T A 17: 6,233,197 V1167E possibly damaging Het
Usp42 G A 5: 143,723,151 T204M probably damaging Het
Vapb A G 2: 173,776,155 K147R possibly damaging Het
Vmn1r228 T C 17: 20,777,160 D32G probably benign Het
Vmn2r33 A G 7: 7,551,169 F795S probably damaging Het
Vmn2r34 A T 7: 7,672,528 N620K probably damaging Het
Vwf G T 6: 125,666,663 C2389F Het
Wdr81 T C 11: 75,442,082 E652G Het
Wdr81 A T 11: 75,452,381 S687T probably benign Het
Zcrb1 A G 15: 93,387,575 probably null Het
Other mutations in Sry
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4304:Sry UTSW Y 2662837 small insertion probably benign
FR4340:Sry UTSW Y 2662824 small insertion probably benign
FR4342:Sry UTSW Y 2662835 small insertion probably benign
FR4342:Sry UTSW Y 2662836 small insertion probably benign
FR4342:Sry UTSW Y 2662839 small insertion probably benign
FR4342:Sry UTSW Y 2663146 small deletion probably benign
FR4449:Sry UTSW Y 2662818 small insertion probably benign
FR4449:Sry UTSW Y 2662832 small insertion probably benign
FR4589:Sry UTSW Y 2662818 small insertion probably benign
FR4737:Sry UTSW Y 2662837 small insertion probably benign
FR4737:Sry UTSW Y 2662838 small insertion probably benign
FR4737:Sry UTSW Y 2663195 small deletion probably benign
FR4976:Sry UTSW Y 2662841 small insertion probably benign
R0288:Sry UTSW Y 2662818 missense unknown
R0506:Sry UTSW Y 2662864 missense unknown
R0690:Sry UTSW Y 2662944 small deletion probably benign
R0784:Sry UTSW Y 2662731 missense unknown
R1373:Sry UTSW Y 2662864 missense unknown
R1555:Sry UTSW Y 2662975 missense unknown
R1638:Sry UTSW Y 2663149 missense unknown
R2110:Sry UTSW Y 2662901 missense unknown
R2212:Sry UTSW Y 2663339 missense probably damaging 0.99
R3150:Sry UTSW Y 2662944 small deletion probably benign
R3552:Sry UTSW Y 2663141 missense unknown
R4877:Sry UTSW Y 2662864 missense unknown
R4888:Sry UTSW Y 2663105 missense unknown
R5028:Sry UTSW Y 2663312 missense probably damaging 0.97
R5266:Sry UTSW Y 2662975 missense unknown
R5305:Sry UTSW Y 2662982 missense unknown
R5335:Sry UTSW Y 2663647 missense probably benign 0.08
R5587:Sry UTSW Y 2662625 missense unknown
R5915:Sry UTSW Y 2662612 missense unknown
R6183:Sry UTSW Y 2662975 missense unknown
R6184:Sry UTSW Y 2662975 missense unknown
R6187:Sry UTSW Y 2662975 missense unknown
R6976:Sry UTSW Y 2662938 missense unknown
R7358:Sry UTSW Y 2662638 small deletion probably benign
R7632:Sry UTSW Y 2662638 small deletion probably benign
R7678:Sry UTSW Y 2663248 missense possibly damaging 0.83
R7737:Sry UTSW Y 2662638 small deletion probably benign
R7812:Sry UTSW Y 2662638 small deletion probably benign
R7829:Sry UTSW Y 2662638 small deletion probably benign
R8005:Sry UTSW Y 2663303 missense possibly damaging 0.88
R8028:Sry UTSW Y 2662638 small deletion probably benign
R8082:Sry UTSW Y 2662589 missense unknown
R8212:Sry UTSW Y 2662638 small deletion probably benign
R8223:Sry UTSW Y 2663204 missense unknown
R8252:Sry UTSW Y 2663298 missense possibly damaging 0.91
R8390:Sry UTSW Y 2662638 small deletion probably benign
R9429:Sry UTSW Y 2662638 small deletion probably benign
RF002:Sry UTSW Y 2662564 small deletion probably benign
RF006:Sry UTSW Y 2662638 small deletion probably benign
RF008:Sry UTSW Y 2662826 small insertion probably benign
RF040:Sry UTSW Y 2662590 small insertion probably benign
RF063:Sry UTSW Y 2662595 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGTCATGAGACTGCCAACC -3'
(R):5'- GCCTGTTGATATCCCCACTG -3'

Sequencing Primer
(F):5'- TGAGACTGCCAACCACAGGG -3'
(R):5'- GCAGCAGCATCAGTTCCATG -3'
Posted On 2021-11-19