Mutagenetix > Incidental Mutation

Incidental Mutation 'R9028:Slc9a2'

686845

Institutional Source

Beutler Lab

Gene Symbol

Slc9a2

Ensembl Gene

ENSMUSG00000026062

Gene Name

solute carrier family 9 (sodium/hydrogen exchanger), member 2

Synonyms

2210416H12Rik, 4932415O19Rik, NHE2

MMRRC Submission

068857-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.058) question?

Stock #

R9028 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

40680574-40769273 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 40726452 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 334 (I334N)

Ref Sequence

ENSEMBL: ENSMUSP00000027231 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027231] [ENSMUST00000192345]

AlphaFold

Q3ZAS0

Predicted Effect

probably damaging
Transcript: ENSMUST00000027231
AA Change: I334N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000027231
Gene: ENSMUSG00000026062
AA Change: I334N

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
low complexity region	40	60	N/A	INTRINSIC
Pfam:Na_H_Exchanger	85	486	1.4e-95	PFAM
low complexity region	528	543	N/A	INTRINSIC
Pfam:NEXCaM_BD	576	685	3e-44	PFAM
low complexity region	738	753	N/A	INTRINSIC
low complexity region	788	793	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000192345
AA Change: I334N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000142144
Gene: ENSMUSG00000026062
AA Change: I334N

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
low complexity region	40	60	N/A	INTRINSIC
Pfam:Na_H_Exchanger	85	336	2.5e-56	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

99% (74/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium-hydrogen exchanger (NHE) protein family. These proteins are involved in sodium-ion transport by exchanging intracellular hydrogen ions to external sodium ions and help in the regulation of cell pH and volume. The encoded protein is localized to the apical membrane and is involved in apical absorption of sodium. [provided by RefSeq, Jun 2016]
PHENOTYPE: Gastric acid secretion is impaired in homozygous mutant mice. The gastric mucosa becomes inflamed and exhibits an altered cellular composition. Mutant mice do not breed well. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5330417C22Rik	G	A	3: 108,463,503	T687I	probably benign	Het
Aasdh	A	G	5: 76,876,130	V1066A	probably damaging	Het
Abca5	T	A	11: 110,298,078	H851L	probably damaging	Het
Actn2	T	C	13: 12,300,978	I218M	possibly damaging	Het
Afmid	G	A	11: 117,836,663	E338K	probably benign	Het
Amer3	G	A	1: 34,588,677	V666I	probably benign	Het
Apol7b	A	G	15: 77,423,416	V293A	probably damaging	Het
Bag6	T	A	17: 35,144,154	S657T	probably benign	Het
Btaf1	T	C	19: 36,969,108	L438P	probably damaging	Het
Cdc20	T	C	4: 118,436,560	E126G	probably benign	Het
Cep97	C	T	16: 55,919,552	W248*	probably null	Het
Cfap69	A	T	5: 5,646,958	S113T	probably benign	Het
Cgrrf1	C	A	14: 46,853,743	D241E	probably benign	Het
Cnksr1	T	C	4: 134,233,297	T280A	possibly damaging	Het
Cox4i1	T	A	8: 120,671,283		probably benign	Het
Cpm	T	A	10: 117,683,509	F441I	probably benign	Het
Cs	A	C	10: 128,353,083	M154L		Het
Dmrta1	T	A	4: 89,691,677	N291K	probably damaging	Het
Dnah7a	T	C	1: 53,521,138	T2125A	probably benign	Het
Dock10	A	T	1: 80,606,295		probably benign	Het
Dok7	A	G	5: 35,079,475	Y369C	probably damaging	Het
E130311K13Rik	T	C	3: 63,915,548	Y225C	probably damaging	Het
F7	T	C	8: 13,026,087	L10P	possibly damaging	Het
Faf1	C	A	4: 109,890,908	T470K	possibly damaging	Het
Fam83h	A	T	15: 76,003,889	L533Q	possibly damaging	Het
Far1	T	A	7: 113,547,422	V129E	probably damaging	Het
Fgfr4	T	C	13: 55,159,154	Y219H	probably damaging	Het
Fryl	A	T	5: 73,098,266	S807R	probably benign	Het
Gaa	T	A	11: 119,270,381	D83E	probably benign	Het
Gm6970	T	C	19: 47,170,690	K149E	unknown	Het
Grm2	A	G	9: 106,651,185	S167P	possibly damaging	Het
Hibch	T	C	1: 52,853,709	L26P	possibly damaging	Het
Hspa9	T	C	18: 34,942,031	E415G	probably damaging	Het
Ipo4	T	C	14: 55,628,951	Y757C	probably damaging	Het
Itk	T	A	11: 46,344,883		probably benign	Het
Kdm5a	C	T	6: 120,439,131	P1671S	probably benign	Het
Kif13a	G	A	13: 46,798,365	P811S	probably damaging	Het
Kif23	T	C	9: 61,921,059	E857G	probably damaging	Het
Kif2b	A	G	11: 91,577,185	S91P	probably benign	Het
Letm1	G	T	5: 33,752,503	Q396K	probably damaging	Het
Map2k6	T	A	11: 110,497,973	M247K		Het
Mga	A	G	2: 119,947,589	I1872V	probably benign	Het
Mmp15	A	T	8: 95,369,688	N369I	probably benign	Het
Myo3a	T	A	2: 22,600,087	S1487T	possibly damaging	Het
Ncam1	T	C	9: 49,507,436	T855A		Het
Ncoa2	A	G	1: 13,152,855	V1182A	probably benign	Het
Nhlrc3	A	T	3: 53,453,571	C254*	probably null	Het
Nlrp1a	C	T	11: 71,122,993	R477H	probably benign	Het
Nox3	T	A	17: 3,665,910	T407S	possibly damaging	Het
Olfr1229	T	A	2: 89,282,332	D267V	probably damaging	Het
Olfr1375	C	T	11: 51,048,833	T242M	probably damaging	Het
Olfr411	T	C	11: 74,346,921	Y101C	probably damaging	Het
Pfkp	T	A	13: 6,605,689	I303F	probably damaging	Het
Pgc	T	C	17: 47,733,058	Y292H	possibly damaging	Het
Phtf2	A	G	5: 20,794,375	Y257H	probably benign	Het
Pkdrej	T	C	15: 85,816,897	N1613D	probably damaging	Het
Prpmp5	C	T	6: 132,312,655	E69K	unknown	Het
Rapgef2	A	G	3: 79,074,344	S1115P	probably damaging	Het
Rbpj	A	G	5: 53,649,690	E260G	possibly damaging	Het
Rrm1	T	A	7: 102,460,398	N476K	probably damaging	Het
Slk	T	G	19: 47,620,073	N488K	probably benign	Het
Smarca5	T	C	8: 80,714,013	I607M	probably damaging	Het
Sspo	G	A	6: 48,496,153	V162M	probably benign	Het
Svep1	T	G	4: 58,145,199	Q422P	possibly damaging	Het
Tcn2	C	T	11: 3,922,111	V339I	probably damaging	Het
Tnfrsf19	T	C	14: 61,005,201	H78R	probably benign	Het
Trav14-3	C	A	14: 53,763,430	Q33K	unknown	Het
Ubtd2	T	C	11: 32,499,432	I93T	possibly damaging	Het
Uhrf2	G	A	19: 30,089,344		probably null	Het
Vmn1r224	T	G	17: 20,419,850	S230A	possibly damaging	Het
Wee2	A	T	6: 40,444,255	H93L	probably benign	Het
Zdhhc17	T	C	10: 110,961,073	E279G	probably damaging	Het
Zfp623	T	A	15: 75,947,500	F102I	probably damaging	Het
Zfpm2	A	C	15: 41,103,362	E1081A	possibly damaging	Het
Zscan18	A	T	7: 12,772,189		probably benign	Het

Other mutations in Slc9a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Slc9a2	APN	1	40767737	missense	probably benign
IGL00487:Slc9a2	APN	1	40742658	missense	probably damaging	0.99
IGL00500:Slc9a2	APN	1	40763583	missense	possibly damaging	0.95
IGL01445:Slc9a2	APN	1	40718810	missense	possibly damaging	0.51
IGL02060:Slc9a2	APN	1	40756293	missense	probably damaging	0.99
IGL02813:Slc9a2	APN	1	40742669	missense	probably damaging	1.00
IGL02894:Slc9a2	APN	1	40763602	missense	probably benign	0.20
IGL02939:Slc9a2	APN	1	40742703	missense	probably damaging	1.00
IGL03193:Slc9a2	APN	1	40756271	missense	probably benign	0.00
putty	UTSW	1	40742653	nonsense	probably null
E0370:Slc9a2	UTSW	1	40763541	critical splice acceptor site	probably null
PIT4377001:Slc9a2	UTSW	1	40743841	missense	probably damaging	1.00
R0009:Slc9a2	UTSW	1	40763602	missense	probably benign	0.38
R0009:Slc9a2	UTSW	1	40763602	missense	probably benign	0.38
R0152:Slc9a2	UTSW	1	40742804	missense	probably damaging	1.00
R0374:Slc9a2	UTSW	1	40743857	missense	possibly damaging	0.93
R1386:Slc9a2	UTSW	1	40719018	missense	probably damaging	1.00
R1485:Slc9a2	UTSW	1	40726388	missense	probably damaging	1.00
R1712:Slc9a2	UTSW	1	40763610	missense	possibly damaging	0.90
R1779:Slc9a2	UTSW	1	40742643	missense	probably damaging	0.99
R2051:Slc9a2	UTSW	1	40726437	missense	probably damaging	1.00
R2166:Slc9a2	UTSW	1	40742768	missense	probably damaging	1.00
R2513:Slc9a2	UTSW	1	40742608	splice site	probably null
R3612:Slc9a2	UTSW	1	40719058	splice site	probably null
R4631:Slc9a2	UTSW	1	40761918	missense	possibly damaging	0.66
R4760:Slc9a2	UTSW	1	40761916	missense	probably damaging	1.00
R4768:Slc9a2	UTSW	1	40726374	missense	probably damaging	1.00
R4769:Slc9a2	UTSW	1	40726374	missense	probably damaging	1.00
R4815:Slc9a2	UTSW	1	40718849	missense	probably benign	0.00
R4920:Slc9a2	UTSW	1	40755718	missense	probably benign	0.05
R5191:Slc9a2	UTSW	1	40743893	missense	probably damaging	1.00
R5963:Slc9a2	UTSW	1	40682036	missense	possibly damaging	0.94
R6322:Slc9a2	UTSW	1	40742653	nonsense	probably null
R6453:Slc9a2	UTSW	1	40742621	missense	possibly damaging	0.64
R6685:Slc9a2	UTSW	1	40718909	missense	probably damaging	0.99
R7088:Slc9a2	UTSW	1	40726379	missense	probably damaging	1.00
R7302:Slc9a2	UTSW	1	40767668	missense	possibly damaging	0.58
R7450:Slc9a2	UTSW	1	40681835	start gained	probably benign
R7670:Slc9a2	UTSW	1	40718997	missense	probably damaging	1.00
R7970:Slc9a2	UTSW	1	40726214	missense	probably damaging	0.98
R8104:Slc9a2	UTSW	1	40718649	missense	probably damaging	1.00
R8776:Slc9a2	UTSW	1	40742729	missense	probably damaging	1.00
R8776-TAIL:Slc9a2	UTSW	1	40742729	missense	probably damaging	1.00
R8887:Slc9a2	UTSW	1	40718849	missense	probably benign	0.01
R9189:Slc9a2	UTSW	1	40755784	missense	probably benign	0.21
R9245:Slc9a2	UTSW	1	40766300	missense	probably benign	0.27
R9250:Slc9a2	UTSW	1	40767827	missense	probably benign	0.00
R9400:Slc9a2	UTSW	1	40719051	missense	possibly damaging	0.65
R9512:Slc9a2	UTSW	1	40682098	missense	probably damaging	0.98
R9583:Slc9a2	UTSW	1	40681901	missense	probably benign
X0054:Slc9a2	UTSW	1	40742687	missense	probably damaging	0.99
Z1176:Slc9a2	UTSW	1	40767711	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGACGTGTTTGCTGGCATC -3'
(R):5'- CCAGCTCCACATTGCAGTAG -3'

Sequencing Primer
(F):5'- GTTTGCTGGCATCGCTAAC -3'
(R):5'- TCTAGTTGTTCTCAGGATAAG -3'

Posted On

2021-11-19