Incidental Mutation 'R9028:Olfr1229'
ID 686849
Institutional Source Beutler Lab
Gene Symbol Olfr1229
Ensembl Gene ENSMUSG00000075095
Gene Name olfactory receptor 1229
Synonyms MOR233-19, MOR233-22, GA_x6K02T2Q125-50727797-50726862
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock # R9028 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 89280476-89288014 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 89282332 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 267 (D267V)
Ref Sequence ENSEMBL: ENSMUSP00000150344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099788] [ENSMUST00000213883] [ENSMUST00000214593]
AlphaFold Q7TQZ9
Predicted Effect probably damaging
Transcript: ENSMUST00000099788
AA Change: D267V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097376
Gene: ENSMUSG00000075095
AA Change: D267V

DomainStartEndE-ValueType
Pfam:7tm_1 39 286 2.9e-29 PFAM
Pfam:7tm_4 138 279 1.7e-42 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213883
AA Change: D267V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000214593
AA Change: D267V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik G A 3: 108,463,503 T687I probably benign Het
Aasdh A G 5: 76,876,130 V1066A probably damaging Het
Abca5 T A 11: 110,298,078 H851L probably damaging Het
Actn2 T C 13: 12,300,978 I218M possibly damaging Het
Afmid G A 11: 117,836,663 E338K probably benign Het
Amer3 G A 1: 34,588,677 V666I probably benign Het
Apol7b A G 15: 77,423,416 V293A probably damaging Het
Bag6 T A 17: 35,144,154 S657T probably benign Het
Btaf1 T C 19: 36,969,108 L438P probably damaging Het
Cdc20 T C 4: 118,436,560 E126G probably benign Het
Cep97 C T 16: 55,919,552 W248* probably null Het
Cfap69 A T 5: 5,646,958 S113T probably benign Het
Cgrrf1 C A 14: 46,853,743 D241E probably benign Het
Cnksr1 T C 4: 134,233,297 T280A possibly damaging Het
Cpm T A 10: 117,683,509 F441I probably benign Het
Cs A C 10: 128,353,083 M154L Het
Dmrta1 T A 4: 89,691,677 N291K probably damaging Het
Dnah7a T C 1: 53,521,138 T2125A probably benign Het
Dok7 A G 5: 35,079,475 Y369C probably damaging Het
E130311K13Rik T C 3: 63,915,548 Y225C probably damaging Het
F7 T C 8: 13,026,087 L10P possibly damaging Het
Faf1 C A 4: 109,890,908 T470K possibly damaging Het
Fam83h A T 15: 76,003,889 L533Q possibly damaging Het
Far1 T A 7: 113,547,422 V129E probably damaging Het
Fgfr4 T C 13: 55,159,154 Y219H probably damaging Het
Fryl A T 5: 73,098,266 S807R probably benign Het
Gaa T A 11: 119,270,381 D83E probably benign Het
Gm6970 T C 19: 47,170,690 K149E unknown Het
Grm2 A G 9: 106,651,185 S167P possibly damaging Het
Hibch T C 1: 52,853,709 L26P possibly damaging Het
Hspa9 T C 18: 34,942,031 E415G probably damaging Het
Ipo4 T C 14: 55,628,951 Y757C probably damaging Het
Kdm5a C T 6: 120,439,131 P1671S probably benign Het
Kif13a G A 13: 46,798,365 P811S probably damaging Het
Kif23 T C 9: 61,921,059 E857G probably damaging Het
Kif2b A G 11: 91,577,185 S91P probably benign Het
Letm1 G T 5: 33,752,503 Q396K probably damaging Het
Map2k6 T A 11: 110,497,973 M247K Het
Mga A G 2: 119,947,589 I1872V probably benign Het
Mmp15 A T 8: 95,369,688 N369I probably benign Het
Myo3a T A 2: 22,600,087 S1487T possibly damaging Het
Ncam1 T C 9: 49,507,436 T855A Het
Ncoa2 A G 1: 13,152,855 V1182A probably benign Het
Nhlrc3 A T 3: 53,453,571 C254* probably null Het
Nlrp1a C T 11: 71,122,993 R477H probably benign Het
Nox3 T A 17: 3,665,910 T407S possibly damaging Het
Olfr1375 C T 11: 51,048,833 T242M probably damaging Het
Olfr411 T C 11: 74,346,921 Y101C probably damaging Het
Pfkp T A 13: 6,605,689 I303F probably damaging Het
Pgc T C 17: 47,733,058 Y292H possibly damaging Het
Phtf2 A G 5: 20,794,375 Y257H probably benign Het
Pkdrej T C 15: 85,816,897 N1613D probably damaging Het
Prpmp5 C T 6: 132,312,655 E69K unknown Het
Rapgef2 A G 3: 79,074,344 S1115P probably damaging Het
Rbpj A G 5: 53,649,690 E260G possibly damaging Het
Rrm1 T A 7: 102,460,398 N476K probably damaging Het
Slc9a2 T A 1: 40,726,452 I334N probably damaging Het
Slk T G 19: 47,620,073 N488K probably benign Het
Smarca5 T C 8: 80,714,013 I607M probably damaging Het
Sspo G A 6: 48,496,153 V162M probably benign Het
Svep1 T G 4: 58,145,199 Q422P possibly damaging Het
Tcn2 C T 11: 3,922,111 V339I probably damaging Het
Tnfrsf19 T C 14: 61,005,201 H78R probably benign Het
Trav14-3 C A 14: 53,763,430 Q33K unknown Het
Ubtd2 T C 11: 32,499,432 I93T possibly damaging Het
Uhrf2 G A 19: 30,089,344 probably null Het
Vmn1r224 T G 17: 20,419,850 S230A possibly damaging Het
Wee2 A T 6: 40,444,255 H93L probably benign Het
Zdhhc17 T C 10: 110,961,073 E279G probably damaging Het
Zfp623 T A 15: 75,947,500 F102I probably damaging Het
Zfpm2 A C 15: 41,103,362 E1081A possibly damaging Het
Other mutations in Olfr1229
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02982:Olfr1229 APN 2 89283109 missense probably damaging 0.98
R1535:Olfr1229 UTSW 2 89283057 missense probably benign 0.14
R1610:Olfr1229 UTSW 2 89282821 missense probably damaging 1.00
R3896:Olfr1229 UTSW 2 89283097 missense possibly damaging 0.78
R4516:Olfr1229 UTSW 2 89282843 missense probably benign 0.05
R4922:Olfr1229 UTSW 2 89282467 missense possibly damaging 0.93
R4990:Olfr1229 UTSW 2 89283327 splice site probably null
R5267:Olfr1229 UTSW 2 89282230 nonsense probably null
R5271:Olfr1229 UTSW 2 89282953 missense probably benign 0.39
R5514:Olfr1229 UTSW 2 89282473 missense probably damaging 1.00
R5621:Olfr1229 UTSW 2 89282353 missense probably damaging 0.97
R7154:Olfr1229 UTSW 2 89282860 missense probably damaging 1.00
R7992:Olfr1229 UTSW 2 89282738 missense probably benign 0.01
Z1176:Olfr1229 UTSW 2 89282537 missense probably benign 0.03
Z1176:Olfr1229 UTSW 2 89282897 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CTCCAAAGTAATGCTAGTTCTGTAC -3'
(R):5'- ACTTGCTTGCACTGACACTC -3'

Sequencing Primer
(F):5'- GAATGAAATGGTTTTGACCTCTTTCC -3'
(R):5'- GCACTGACACTCACATCTTTGG -3'
Posted On 2021-11-19