Mutagenetix > Incidental Mutation

Incidental Mutation 'R9028:Mga'

686850

Institutional Source

Beutler Lab

Gene Symbol

Mga

Ensembl Gene

ENSMUSG00000033943

Gene Name

MAX gene associated

Synonyms

D030062C11Rik, Mga, Mad5, C130042M01Rik

MMRRC Submission

068857-MU

Accession Numbers

Ncbi RefSeq: NM_013720.2, NM_001164274.1; MGI: 1352483

Essential gene?

Probably essential (E-score: 0.941) question?

Stock #

R9028 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

119897228-119969581 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 119947589 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 1872 (I1872V)

Ref Sequence

ENSEMBL: ENSMUSP00000119044 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046717] [ENSMUST00000079934] [ENSMUST00000110773] [ENSMUST00000110774] [ENSMUST00000156510]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000046717
AA Change: I2042V

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000043795
Gene: ENSMUSG00000033943
AA Change: I2042V

Domain	Start	End	E-Value	Type
Blast:TBOX	6	73	6e-27	BLAST
TBOX	74	265	2.34e-100	SMART
low complexity region	969	978	N/A	INTRINSIC
low complexity region	1017	1031	N/A	INTRINSIC
low complexity region	1112	1138	N/A	INTRINSIC
low complexity region	1248	1269	N/A	INTRINSIC
low complexity region	1301	1315	N/A	INTRINSIC
low complexity region	1564	1581	N/A	INTRINSIC
low complexity region	1634	1649	N/A	INTRINSIC
low complexity region	1681	1716	N/A	INTRINSIC
low complexity region	1796	1818	N/A	INTRINSIC
low complexity region	1833	1850	N/A	INTRINSIC
low complexity region	1977	1992	N/A	INTRINSIC
low complexity region	2183	2197	N/A	INTRINSIC
low complexity region	2241	2259	N/A	INTRINSIC
HLH	2368	2419	8.27e-7	SMART
low complexity region	2748	2769	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000079934
AA Change: I1872V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000078853
Gene: ENSMUSG00000033943
AA Change: I1872V

Domain	Start	End	E-Value	Type
Blast:TBOX	6	73	5e-27	BLAST
TBOX	74	265	2.34e-100	SMART
low complexity region	969	978	N/A	INTRINSIC
low complexity region	1017	1031	N/A	INTRINSIC
low complexity region	1112	1138	N/A	INTRINSIC
low complexity region	1247	1268	N/A	INTRINSIC
low complexity region	1300	1314	N/A	INTRINSIC
low complexity region	1626	1648	N/A	INTRINSIC
low complexity region	1663	1680	N/A	INTRINSIC
low complexity region	1807	1822	N/A	INTRINSIC
low complexity region	2013	2027	N/A	INTRINSIC
low complexity region	2071	2089	N/A	INTRINSIC
HLH	2198	2249	8.27e-7	SMART
low complexity region	2578	2599	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110773
AA Change: I1963V

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000106400
Gene: ENSMUSG00000033943
AA Change: I1963V

Domain	Start	End	E-Value	Type
Blast:TBOX	6	73	5e-27	BLAST
TBOX	74	265	2.34e-100	SMART
low complexity region	890	899	N/A	INTRINSIC
low complexity region	938	952	N/A	INTRINSIC
low complexity region	1033	1059	N/A	INTRINSIC
low complexity region	1169	1190	N/A	INTRINSIC
low complexity region	1222	1236	N/A	INTRINSIC
low complexity region	1485	1502	N/A	INTRINSIC
low complexity region	1555	1570	N/A	INTRINSIC
low complexity region	1602	1637	N/A	INTRINSIC
low complexity region	1717	1739	N/A	INTRINSIC
low complexity region	1754	1771	N/A	INTRINSIC
low complexity region	1898	1913	N/A	INTRINSIC
low complexity region	2104	2118	N/A	INTRINSIC
low complexity region	2162	2180	N/A	INTRINSIC
HLH	2289	2340	8.27e-7	SMART
low complexity region	2669	2690	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110774
AA Change: I2081V

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000106401
Gene: ENSMUSG00000033943
AA Change: I2081V

Domain	Start	End	E-Value	Type
Blast:TBOX	6	73	7e-27	BLAST
TBOX	74	265	2.34e-100	SMART
low complexity region	969	978	N/A	INTRINSIC
low complexity region	1017	1031	N/A	INTRINSIC
Pfam:DUF4801	1037	1085	1e-19	PFAM
low complexity region	1112	1138	N/A	INTRINSIC
low complexity region	1248	1269	N/A	INTRINSIC
low complexity region	1301	1315	N/A	INTRINSIC
low complexity region	1564	1581	N/A	INTRINSIC
low complexity region	1634	1649	N/A	INTRINSIC
low complexity region	1681	1716	N/A	INTRINSIC
low complexity region	1835	1857	N/A	INTRINSIC
low complexity region	1872	1889	N/A	INTRINSIC
low complexity region	2016	2031	N/A	INTRINSIC
low complexity region	2222	2236	N/A	INTRINSIC
low complexity region	2280	2298	N/A	INTRINSIC
HLH	2407	2458	8.27e-7	SMART
low complexity region	2787	2808	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000156510
AA Change: I1872V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000119044
Gene: ENSMUSG00000033943
AA Change: I1872V

Domain	Start	End	E-Value	Type
Blast:TBOX	6	73	4e-27	BLAST
TBOX	74	265	2.34e-100	SMART
low complexity region	969	978	N/A	INTRINSIC
low complexity region	1017	1031	N/A	INTRINSIC
low complexity region	1112	1138	N/A	INTRINSIC
low complexity region	1247	1268	N/A	INTRINSIC
low complexity region	1300	1314	N/A	INTRINSIC
low complexity region	1626	1648	N/A	INTRINSIC
low complexity region	1663	1680	N/A	INTRINSIC
low complexity region	1807	1822	N/A	INTRINSIC
low complexity region	2013	2027	N/A	INTRINSIC
low complexity region	2071	2089	N/A	INTRINSIC
HLH	2198	2249	8.27e-7	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

99% (74/75)

MGI Phenotype

PHENOTYPE: Embryos homozygous for a gene trap allele die shortly after implantation due to defective development of the inner cell mass (ICM) and the epiblast. ICM derivatives fail to develop past E4.5 and show increased apoptosis but no change in cell proliferation. [provided by MGI curators]

Allele List at MGI

All alleles(135) : Gene trapped(135)

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5330417C22Rik	G	A	3: 108,463,503	T687I	probably benign	Het
Aasdh	A	G	5: 76,876,130	V1066A	probably damaging	Het
Abca5	T	A	11: 110,298,078	H851L	probably damaging	Het
Actn2	T	C	13: 12,300,978	I218M	possibly damaging	Het
Afmid	G	A	11: 117,836,663	E338K	probably benign	Het
Amer3	G	A	1: 34,588,677	V666I	probably benign	Het
Apol7b	A	G	15: 77,423,416	V293A	probably damaging	Het
Bag6	T	A	17: 35,144,154	S657T	probably benign	Het
Btaf1	T	C	19: 36,969,108	L438P	probably damaging	Het
Cdc20	T	C	4: 118,436,560	E126G	probably benign	Het
Cep97	C	T	16: 55,919,552	W248*	probably null	Het
Cfap69	A	T	5: 5,646,958	S113T	probably benign	Het
Cgrrf1	C	A	14: 46,853,743	D241E	probably benign	Het
Cnksr1	T	C	4: 134,233,297	T280A	possibly damaging	Het
Cox4i1	T	A	8: 120,671,283		probably benign	Het
Cpm	T	A	10: 117,683,509	F441I	probably benign	Het
Cs	A	C	10: 128,353,083	M154L		Het
Dmrta1	T	A	4: 89,691,677	N291K	probably damaging	Het
Dnah7a	T	C	1: 53,521,138	T2125A	probably benign	Het
Dock10	A	T	1: 80,606,295		probably benign	Het
Dok7	A	G	5: 35,079,475	Y369C	probably damaging	Het
E130311K13Rik	T	C	3: 63,915,548	Y225C	probably damaging	Het
F7	T	C	8: 13,026,087	L10P	possibly damaging	Het
Faf1	C	A	4: 109,890,908	T470K	possibly damaging	Het
Fam83h	A	T	15: 76,003,889	L533Q	possibly damaging	Het
Far1	T	A	7: 113,547,422	V129E	probably damaging	Het
Fgfr4	T	C	13: 55,159,154	Y219H	probably damaging	Het
Fryl	A	T	5: 73,098,266	S807R	probably benign	Het
Gaa	T	A	11: 119,270,381	D83E	probably benign	Het
Gm6970	T	C	19: 47,170,690	K149E	unknown	Het
Grm2	A	G	9: 106,651,185	S167P	possibly damaging	Het
Hibch	T	C	1: 52,853,709	L26P	possibly damaging	Het
Hspa9	T	C	18: 34,942,031	E415G	probably damaging	Het
Ipo4	T	C	14: 55,628,951	Y757C	probably damaging	Het
Itk	T	A	11: 46,344,883		probably benign	Het
Kdm5a	C	T	6: 120,439,131	P1671S	probably benign	Het
Kif13a	G	A	13: 46,798,365	P811S	probably damaging	Het
Kif23	T	C	9: 61,921,059	E857G	probably damaging	Het
Kif2b	A	G	11: 91,577,185	S91P	probably benign	Het
Letm1	G	T	5: 33,752,503	Q396K	probably damaging	Het
Map2k6	T	A	11: 110,497,973	M247K		Het
Mmp15	A	T	8: 95,369,688	N369I	probably benign	Het
Myo3a	T	A	2: 22,600,087	S1487T	possibly damaging	Het
Ncam1	T	C	9: 49,507,436	T855A		Het
Ncoa2	A	G	1: 13,152,855	V1182A	probably benign	Het
Nhlrc3	A	T	3: 53,453,571	C254*	probably null	Het
Nlrp1a	C	T	11: 71,122,993	R477H	probably benign	Het
Nox3	T	A	17: 3,665,910	T407S	possibly damaging	Het
Olfr1229	T	A	2: 89,282,332	D267V	probably damaging	Het
Olfr1375	C	T	11: 51,048,833	T242M	probably damaging	Het
Olfr411	T	C	11: 74,346,921	Y101C	probably damaging	Het
Pfkp	T	A	13: 6,605,689	I303F	probably damaging	Het
Pgc	T	C	17: 47,733,058	Y292H	possibly damaging	Het
Phtf2	A	G	5: 20,794,375	Y257H	probably benign	Het
Pkdrej	T	C	15: 85,816,897	N1613D	probably damaging	Het
Prpmp5	C	T	6: 132,312,655	E69K	unknown	Het
Rapgef2	A	G	3: 79,074,344	S1115P	probably damaging	Het
Rbpj	A	G	5: 53,649,690	E260G	possibly damaging	Het
Rrm1	T	A	7: 102,460,398	N476K	probably damaging	Het
Slc9a2	T	A	1: 40,726,452	I334N	probably damaging	Het
Slk	T	G	19: 47,620,073	N488K	probably benign	Het
Smarca5	T	C	8: 80,714,013	I607M	probably damaging	Het
Sspo	G	A	6: 48,496,153	V162M	probably benign	Het
Svep1	T	G	4: 58,145,199	Q422P	possibly damaging	Het
Tcn2	C	T	11: 3,922,111	V339I	probably damaging	Het
Tnfrsf19	T	C	14: 61,005,201	H78R	probably benign	Het
Trav14-3	C	A	14: 53,763,430	Q33K	unknown	Het
Ubtd2	T	C	11: 32,499,432	I93T	possibly damaging	Het
Uhrf2	G	A	19: 30,089,344		probably null	Het
Vmn1r224	T	G	17: 20,419,850	S230A	possibly damaging	Het
Wee2	A	T	6: 40,444,255	H93L	probably benign	Het
Zdhhc17	T	C	10: 110,961,073	E279G	probably damaging	Het
Zfp623	T	A	15: 75,947,500	F102I	probably damaging	Het
Zfpm2	A	C	15: 41,103,362	E1081A	possibly damaging	Het
Zscan18	A	T	7: 12,772,189		probably benign	Het

Other mutations in Mga

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00551:Mga	APN	2	119919814	missense	possibly damaging	0.65
IGL00719:Mga	APN	2	119947453	nonsense	probably null
IGL01619:Mga	APN	2	119931828	missense	possibly damaging	0.46
IGL01721:Mga	APN	2	119935239	missense	probably damaging	1.00
IGL01759:Mga	APN	2	119951195	missense	possibly damaging	0.92
IGL01785:Mga	APN	2	119902912	missense	probably damaging	1.00
IGL01786:Mga	APN	2	119902912	missense	probably damaging	1.00
IGL01950:Mga	APN	2	119941654	missense	possibly damaging	0.60
IGL01960:Mga	APN	2	119938657	missense	probably damaging	1.00
IGL02086:Mga	APN	2	119924036	missense	probably damaging	0.99
IGL02364:Mga	APN	2	119964054	missense	possibly damaging	0.66
IGL02602:Mga	APN	2	119931884	missense	possibly damaging	0.66
IGL02751:Mga	APN	2	119947770	missense	possibly damaging	0.82
IGL02794:Mga	APN	2	119946289	missense	possibly damaging	0.84
IGL03247:Mga	APN	2	119935513	missense	possibly damaging	0.81
IGL03303:Mga	APN	2	119903452	missense	probably damaging	1.00
PIT4515001:Mga	UTSW	2	119916504	missense	probably damaging	1.00
R0060:Mga	UTSW	2	119960961	critical splice donor site	probably null
R0060:Mga	UTSW	2	119960961	critical splice donor site	probably null
R0417:Mga	UTSW	2	119902790	missense	probably damaging	0.99
R0449:Mga	UTSW	2	119941381	missense	probably damaging	1.00
R0457:Mga	UTSW	2	119916488	missense	probably damaging	0.98
R0538:Mga	UTSW	2	119919706	critical splice donor site	probably null
R0568:Mga	UTSW	2	119935422	missense	probably damaging	1.00
R0614:Mga	UTSW	2	119964466	missense	probably damaging	1.00
R0671:Mga	UTSW	2	119919910	splice site	probably null
R0811:Mga	UTSW	2	119947961	missense	probably damaging	0.99
R0812:Mga	UTSW	2	119947961	missense	probably damaging	0.99
R0948:Mga	UTSW	2	119941659	missense	possibly damaging	0.77
R1177:Mga	UTSW	2	119926446	missense	probably damaging	1.00
R1445:Mga	UTSW	2	119902698	missense	probably damaging	1.00
R1476:Mga	UTSW	2	119941675	missense	probably damaging	0.96
R1527:Mga	UTSW	2	119916597	missense	probably damaging	1.00
R1583:Mga	UTSW	2	119963960	missense	possibly damaging	0.66
R1592:Mga	UTSW	2	119964666	missense	possibly damaging	0.93
R1627:Mga	UTSW	2	119964562	missense	probably damaging	1.00
R1658:Mga	UTSW	2	119941689	missense	possibly damaging	0.63
R1677:Mga	UTSW	2	119960852	missense	possibly damaging	0.92
R1887:Mga	UTSW	2	119923617	missense	probably damaging	1.00
R1908:Mga	UTSW	2	119926594	missense	possibly damaging	0.66
R1909:Mga	UTSW	2	119926594	missense	possibly damaging	0.66
R2061:Mga	UTSW	2	119964980	unclassified	probably benign
R2145:Mga	UTSW	2	119964157	missense	possibly damaging	0.85
R2159:Mga	UTSW	2	119919643	missense	probably damaging	0.96
R2179:Mga	UTSW	2	119960442	missense	probably damaging	0.99
R2281:Mga	UTSW	2	119903723	missense	probably benign
R2423:Mga	UTSW	2	119964793	missense	probably damaging	1.00
R3620:Mga	UTSW	2	119916668	missense	probably damaging	1.00
R3622:Mga	UTSW	2	119941764	missense	probably damaging	1.00
R3624:Mga	UTSW	2	119941764	missense	probably damaging	1.00
R3802:Mga	UTSW	2	119947339	missense	probably damaging	0.96
R4011:Mga	UTSW	2	119931780	missense	probably damaging	1.00
R4065:Mga	UTSW	2	119947002	missense	probably damaging	1.00
R4520:Mga	UTSW	2	119948098	missense	possibly damaging	0.85
R4649:Mga	UTSW	2	119941493	missense	possibly damaging	0.81
R4660:Mga	UTSW	2	119938623	intron	probably benign
R4757:Mga	UTSW	2	119903639	missense	possibly damaging	0.82
R4771:Mga	UTSW	2	119964294	missense	probably damaging	1.00
R4784:Mga	UTSW	2	119903057	missense	probably damaging	1.00
R4866:Mga	UTSW	2	119964054	missense	possibly damaging	0.66
R4900:Mga	UTSW	2	119964054	missense	possibly damaging	0.66
R4952:Mga	UTSW	2	119903301	missense	probably damaging	1.00
R4995:Mga	UTSW	2	119932582	nonsense	probably null
R5020:Mga	UTSW	2	119951173	nonsense	probably null
R5082:Mga	UTSW	2	119903344	missense	probably damaging	0.98
R5208:Mga	UTSW	2	119947981	missense	possibly damaging	0.83
R5454:Mga	UTSW	2	119903329	missense	probably damaging	0.99
R5466:Mga	UTSW	2	119902697	missense	probably damaging	1.00
R5484:Mga	UTSW	2	119916626	missense	possibly damaging	0.58
R5669:Mga	UTSW	2	119903426	missense	probably damaging	1.00
R5819:Mga	UTSW	2	119941263	missense	possibly damaging	0.61
R5916:Mga	UTSW	2	119964312	missense	probably benign	0.27
R5942:Mga	UTSW	2	119946959	missense	probably benign	0.41
R6305:Mga	UTSW	2	119947698	missense	probably benign	0.00
R6434:Mga	UTSW	2	119923938	missense	probably damaging	0.99
R6467:Mga	UTSW	2	119946295	missense	probably damaging	1.00
R6488:Mga	UTSW	2	119960907	missense	probably damaging	1.00
R6630:Mga	UTSW	2	119923659	missense	probably damaging	0.99
R6790:Mga	UTSW	2	119923754	missense	probably damaging	0.99
R7029:Mga	UTSW	2	119923550	missense	probably damaging	1.00
R7039:Mga	UTSW	2	119932678	missense	probably benign	0.28
R7088:Mga	UTSW	2	119961936	missense	probably damaging	1.00
R7195:Mga	UTSW	2	119917328	missense	probably damaging	1.00
R7273:Mga	UTSW	2	119935214	missense	probably damaging	1.00
R7286:Mga	UTSW	2	119964788	missense	possibly damaging	0.93
R7346:Mga	UTSW	2	119935527	missense	possibly damaging	0.56
R7383:Mga	UTSW	2	119960340	missense	probably damaging	0.99
R7469:Mga	UTSW	2	119903046	missense	probably damaging	1.00
R7484:Mga	UTSW	2	119946229	missense	probably damaging	0.99
R7537:Mga	UTSW	2	119935551	missense	probably damaging	0.97
R7781:Mga	UTSW	2	119917357	missense	probably damaging	1.00
R7921:Mga	UTSW	2	119919678	missense	probably damaging	1.00
R8165:Mga	UTSW	2	119947238	missense	probably benign	0.12
R8226:Mga	UTSW	2	119960385	missense	probably benign	0.33
R8305:Mga	UTSW	2	119946319	missense	possibly damaging	0.77
R8309:Mga	UTSW	2	119960930	missense	probably damaging	1.00
R8363:Mga	UTSW	2	119963926	missense	probably benign	0.43
R8388:Mga	UTSW	2	119964081	missense	probably benign	0.00
R8524:Mga	UTSW	2	119941516	missense	probably damaging	0.97
R8693:Mga	UTSW	2	119963926	missense	possibly damaging	0.65
R8837:Mga	UTSW	2	119938791	splice site	probably benign
R8916:Mga	UTSW	2	119958338	missense	possibly damaging	0.92
R8936:Mga	UTSW	2	119964228	missense	probably damaging	1.00
R9145:Mga	UTSW	2	119964012	missense	probably benign
R9155:Mga	UTSW	2	119926532	missense	probably damaging	1.00
R9308:Mga	UTSW	2	119923888	missense	possibly damaging	0.91
R9342:Mga	UTSW	2	119948175	missense	probably benign
R9347:Mga	UTSW	2	119903037	missense	probably damaging	1.00
R9390:Mga	UTSW	2	119963851	missense	probably damaging	0.99
R9408:Mga	UTSW	2	119935518	missense	possibly damaging	0.92
R9488:Mga	UTSW	2	119964823	missense	possibly damaging	0.90
R9495:Mga	UTSW	2	119951195	missense	possibly damaging	0.92
R9521:Mga	UTSW	2	119964498	missense	probably damaging	0.99
R9780:Mga	UTSW	2	119916772	missense	probably benign	0.26

Predicted Primers

PCR Primer
(F):5'- GGGTGATCTTTTGGATGAAGAAACC -3'
(R):5'- AAGACTGTCCTTCCCCAGAG -3'

Sequencing Primer
(F):5'- CCTTAGGGAAGATGCCAGACCTTATG -3'
(R):5'- CAGAGAATCTTCACAATCCTTCTTGG -3'

Posted On

2021-11-19