Mutagenetix > Incidental Mutation

Incidental Mutation 'R9028:Cnksr1'

686859

Institutional Source

Beutler Lab

Gene Symbol

Cnksr1

Ensembl Gene

ENSMUSG00000028841

Gene Name

connector enhancer of kinase suppressor of Ras 1

Synonyms

MMRRC Submission

068857-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.353) question?

Stock #

R9028 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

134228041-134238399 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 134233297 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 280 (T280A)

Ref Sequence

ENSEMBL: ENSMUSP00000030645 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030645]

AlphaFold

A2A9K7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000030645
AA Change: T280A

PolyPhen 2 Score 0.478 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000030645
Gene: ENSMUSG00000028841
AA Change: T280A

Domain	Start	End	E-Value	Type
SAM	4	70	1.44e-9	SMART
Pfam:CRIC_ras_sig	78	162	4.2e-26	PFAM
PDZ	206	276	1.48e-3	SMART
low complexity region	285	303	N/A	INTRINSIC
low complexity region	333	347	N/A	INTRINSIC
PH	388	488	4.38e-19	SMART
coiled coil region	596	624	N/A	INTRINSIC

Meta Mutation Damage Score

0.1098

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

99% (74/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing several motifs involved in protein-protein interaction, including PDZ, PH (Pleckstrin homology), and SAM (sterile alpha motif) domains. The encoded protein acts as a scaffold component for receptor tyrosine kinase signaling and may mediate crosstalk between different signaling pathways. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5330417C22Rik	G	A	3: 108,463,503	T687I	probably benign	Het
Aasdh	A	G	5: 76,876,130	V1066A	probably damaging	Het
Abca5	T	A	11: 110,298,078	H851L	probably damaging	Het
Actn2	T	C	13: 12,300,978	I218M	possibly damaging	Het
Afmid	G	A	11: 117,836,663	E338K	probably benign	Het
Amer3	G	A	1: 34,588,677	V666I	probably benign	Het
Apol7b	A	G	15: 77,423,416	V293A	probably damaging	Het
Bag6	T	A	17: 35,144,154	S657T	probably benign	Het
Btaf1	T	C	19: 36,969,108	L438P	probably damaging	Het
Cdc20	T	C	4: 118,436,560	E126G	probably benign	Het
Cep97	C	T	16: 55,919,552	W248*	probably null	Het
Cfap69	A	T	5: 5,646,958	S113T	probably benign	Het
Cgrrf1	C	A	14: 46,853,743	D241E	probably benign	Het
Cox4i1	T	A	8: 120,671,283		probably benign	Het
Cpm	T	A	10: 117,683,509	F441I	probably benign	Het
Cs	A	C	10: 128,353,083	M154L		Het
Dmrta1	T	A	4: 89,691,677	N291K	probably damaging	Het
Dnah7a	T	C	1: 53,521,138	T2125A	probably benign	Het
Dock10	A	T	1: 80,606,295		probably benign	Het
Dok7	A	G	5: 35,079,475	Y369C	probably damaging	Het
E130311K13Rik	T	C	3: 63,915,548	Y225C	probably damaging	Het
F7	T	C	8: 13,026,087	L10P	possibly damaging	Het
Faf1	C	A	4: 109,890,908	T470K	possibly damaging	Het
Fam83h	A	T	15: 76,003,889	L533Q	possibly damaging	Het
Far1	T	A	7: 113,547,422	V129E	probably damaging	Het
Fgfr4	T	C	13: 55,159,154	Y219H	probably damaging	Het
Fryl	A	T	5: 73,098,266	S807R	probably benign	Het
Gaa	T	A	11: 119,270,381	D83E	probably benign	Het
Gm6970	T	C	19: 47,170,690	K149E	unknown	Het
Grm2	A	G	9: 106,651,185	S167P	possibly damaging	Het
Hibch	T	C	1: 52,853,709	L26P	possibly damaging	Het
Hspa9	T	C	18: 34,942,031	E415G	probably damaging	Het
Ipo4	T	C	14: 55,628,951	Y757C	probably damaging	Het
Itk	T	A	11: 46,344,883		probably benign	Het
Kdm5a	C	T	6: 120,439,131	P1671S	probably benign	Het
Kif13a	G	A	13: 46,798,365	P811S	probably damaging	Het
Kif23	T	C	9: 61,921,059	E857G	probably damaging	Het
Kif2b	A	G	11: 91,577,185	S91P	probably benign	Het
Letm1	G	T	5: 33,752,503	Q396K	probably damaging	Het
Map2k6	T	A	11: 110,497,973	M247K		Het
Mga	A	G	2: 119,947,589	I1872V	probably benign	Het
Mmp15	A	T	8: 95,369,688	N369I	probably benign	Het
Myo3a	T	A	2: 22,600,087	S1487T	possibly damaging	Het
Ncam1	T	C	9: 49,507,436	T855A		Het
Ncoa2	A	G	1: 13,152,855	V1182A	probably benign	Het
Nhlrc3	A	T	3: 53,453,571	C254*	probably null	Het
Nlrp1a	C	T	11: 71,122,993	R477H	probably benign	Het
Nox3	T	A	17: 3,665,910	T407S	possibly damaging	Het
Olfr1229	T	A	2: 89,282,332	D267V	probably damaging	Het
Olfr1375	C	T	11: 51,048,833	T242M	probably damaging	Het
Olfr411	T	C	11: 74,346,921	Y101C	probably damaging	Het
Pfkp	T	A	13: 6,605,689	I303F	probably damaging	Het
Pgc	T	C	17: 47,733,058	Y292H	possibly damaging	Het
Phtf2	A	G	5: 20,794,375	Y257H	probably benign	Het
Pkdrej	T	C	15: 85,816,897	N1613D	probably damaging	Het
Prpmp5	C	T	6: 132,312,655	E69K	unknown	Het
Rapgef2	A	G	3: 79,074,344	S1115P	probably damaging	Het
Rbpj	A	G	5: 53,649,690	E260G	possibly damaging	Het
Rrm1	T	A	7: 102,460,398	N476K	probably damaging	Het
Slc9a2	T	A	1: 40,726,452	I334N	probably damaging	Het
Slk	T	G	19: 47,620,073	N488K	probably benign	Het
Smarca5	T	C	8: 80,714,013	I607M	probably damaging	Het
Sspo	G	A	6: 48,496,153	V162M	probably benign	Het
Svep1	T	G	4: 58,145,199	Q422P	possibly damaging	Het
Tcn2	C	T	11: 3,922,111	V339I	probably damaging	Het
Tnfrsf19	T	C	14: 61,005,201	H78R	probably benign	Het
Trav14-3	C	A	14: 53,763,430	Q33K	unknown	Het
Ubtd2	T	C	11: 32,499,432	I93T	possibly damaging	Het
Uhrf2	G	A	19: 30,089,344		probably null	Het
Vmn1r224	T	G	17: 20,419,850	S230A	possibly damaging	Het
Wee2	A	T	6: 40,444,255	H93L	probably benign	Het
Zdhhc17	T	C	10: 110,961,073	E279G	probably damaging	Het
Zfp623	T	A	15: 75,947,500	F102I	probably damaging	Het
Zfpm2	A	C	15: 41,103,362	E1081A	possibly damaging	Het
Zscan18	A	T	7: 12,772,189		probably benign	Het

Other mutations in Cnksr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00718:Cnksr1	APN	4	134234701	missense	probably benign	0.39
IGL01311:Cnksr1	APN	4	134230466	missense	probably damaging	1.00
IGL01872:Cnksr1	APN	4	134228964	missense	probably benign	0.13
IGL02082:Cnksr1	APN	4	134236052	missense	probably damaging	1.00
IGL02405:Cnksr1	APN	4	134236281	missense	possibly damaging	0.88
IGL02669:Cnksr1	APN	4	134230463	missense	probably damaging	0.98
IGL02948:Cnksr1	APN	4	134235106	splice site	probably null
IGL03037:Cnksr1	APN	4	134235106	splice site	probably null
IGL03381:Cnksr1	APN	4	134232171	missense	probably damaging	0.99
R0855:Cnksr1	UTSW	4	134233066	splice site	probably benign
R1958:Cnksr1	UTSW	4	134228416	missense	probably benign	0.02
R2049:Cnksr1	UTSW	4	134229628	missense	probably damaging	1.00
R2140:Cnksr1	UTSW	4	134229628	missense	probably damaging	1.00
R2141:Cnksr1	UTSW	4	134229628	missense	probably damaging	1.00
R2142:Cnksr1	UTSW	4	134229628	missense	probably damaging	1.00
R2389:Cnksr1	UTSW	4	134233746	missense	probably benign	0.03
R2495:Cnksr1	UTSW	4	134232162	missense	probably benign	0.00
R4596:Cnksr1	UTSW	4	134233878	missense	possibly damaging	0.90
R4668:Cnksr1	UTSW	4	134232971	intron	probably benign
R4896:Cnksr1	UTSW	4	134229675	splice site	probably null
R5367:Cnksr1	UTSW	4	134230214	missense	possibly damaging	0.94
R5673:Cnksr1	UTSW	4	134235188	missense	probably damaging	1.00
R5844:Cnksr1	UTSW	4	134228264	unclassified	probably benign
R6153:Cnksr1	UTSW	4	134233893	missense	probably damaging	1.00
R7207:Cnksr1	UTSW	4	134235123	missense	possibly damaging	0.75
R7261:Cnksr1	UTSW	4	134235773	splice site	probably null
R7978:Cnksr1	UTSW	4	134236031	missense	probably damaging	1.00
R8310:Cnksr1	UTSW	4	134229419	missense	probably damaging	1.00
R8855:Cnksr1	UTSW	4	134232183	missense	probably damaging	1.00
R9019:Cnksr1	UTSW	4	134232054	missense	probably damaging	1.00
R9102:Cnksr1	UTSW	4	134229012	missense	probably damaging	1.00
R9310:Cnksr1	UTSW	4	134229019	missense	probably damaging	1.00
R9344:Cnksr1	UTSW	4	134236197	missense	probably damaging	1.00
R9435:Cnksr1	UTSW	4	134234574	missense	possibly damaging	0.94
Z1176:Cnksr1	UTSW	4	134232135	missense	probably damaging	1.00
Z1177:Cnksr1	UTSW	4	134232150	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AGAGCTTGTTACCTGGGAGAC -3'
(R):5'- GGTTAAACTCGGTTAAAGGGC -3'

Sequencing Primer
(F):5'- TACCTGGGAGACGGTGG -3'
(R):5'- AAGCTCCCTGAAGGTGGTG -3'

Posted On

2021-11-19