Incidental Mutation 'R9028:Letm1'
ID 686862
Institutional Source Beutler Lab
Gene Symbol Letm1
Ensembl Gene ENSMUSG00000005299
Gene Name leucine zipper-EF-hand containing transmembrane protein 1
Synonyms
MMRRC Submission 068857-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.961) question?
Stock # R9028 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 33897017-33940061 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 33909847 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 396 (Q396K)
Ref Sequence ENSEMBL: ENSMUSP00000005431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005431]
AlphaFold Q9Z2I0
Predicted Effect probably damaging
Transcript: ENSMUST00000005431
AA Change: Q396K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000005431
Gene: ENSMUSG00000005299
AA Change: Q396K

DomainStartEndE-ValueType
low complexity region 10 30 N/A INTRINSIC
low complexity region 120 135 N/A INTRINSIC
Pfam:LETM1 152 417 1.2e-111 PFAM
coiled coil region 445 493 N/A INTRINSIC
low complexity region 503 513 N/A INTRINSIC
coiled coil region 537 598 N/A INTRINSIC
SCOP:d1c7va_ 647 691 4e-3 SMART
coiled coil region 708 738 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is localized to the inner mitochondrial membrane. The protein functions to maintain the mitochondrial tubular shapes and is required for normal mitochondrial morphology and cellular viability. Mutations in this gene cause Wolf-Hirschhorn syndrome, a complex malformation syndrome caused by the deletion of parts of the distal short arm of chromosome 4. Related pseudogenes have been identified on chromosomes 8, 15 and 19. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous deletion of this gene causes embryonic lethality prior to E6.5 while ~50% of heterozygotes die before E13.5. Surviving heterozygous mice show altered glucose metabolism, impaired control of brain ATP levels, and increased susceptibility to kainic acid-induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 77,023,977 (GRCm39) V1066A probably damaging Het
Abca5 T A 11: 110,188,904 (GRCm39) H851L probably damaging Het
Actn2 T C 13: 12,315,864 (GRCm39) I218M possibly damaging Het
Afmid G A 11: 117,727,489 (GRCm39) E338K probably benign Het
Amer3 G A 1: 34,627,758 (GRCm39) V666I probably benign Het
Apol7b A G 15: 77,307,616 (GRCm39) V293A probably damaging Het
Bag6 T A 17: 35,363,130 (GRCm39) S657T probably benign Het
Btaf1 T C 19: 36,946,508 (GRCm39) L438P probably damaging Het
Cdc20 T C 4: 118,293,757 (GRCm39) E126G probably benign Het
Cep97 C T 16: 55,739,915 (GRCm39) W248* probably null Het
Cfap69 A T 5: 5,696,958 (GRCm39) S113T probably benign Het
Cgrrf1 C A 14: 47,091,200 (GRCm39) D241E probably benign Het
Cnksr1 T C 4: 133,960,608 (GRCm39) T280A possibly damaging Het
Cox4i1 T A 8: 121,398,022 (GRCm39) probably benign Het
Cpm T A 10: 117,519,414 (GRCm39) F441I probably benign Het
Cs A C 10: 128,188,952 (GRCm39) M154L Het
Dmrta1 T A 4: 89,579,914 (GRCm39) N291K probably damaging Het
Dnah7a T C 1: 53,560,297 (GRCm39) T2125A probably benign Het
Dock10 A T 1: 80,584,012 (GRCm39) probably benign Het
Dok7 A G 5: 35,236,819 (GRCm39) Y369C probably damaging Het
E130311K13Rik T C 3: 63,822,969 (GRCm39) Y225C probably damaging Het
Elapor1 G A 3: 108,370,819 (GRCm39) T687I probably benign Het
F7 T C 8: 13,076,087 (GRCm39) L10P possibly damaging Het
Faf1 C A 4: 109,748,105 (GRCm39) T470K possibly damaging Het
Fam83h A T 15: 75,875,738 (GRCm39) L533Q possibly damaging Het
Far1 T A 7: 113,146,629 (GRCm39) V129E probably damaging Het
Fgfr4 T C 13: 55,306,967 (GRCm39) Y219H probably damaging Het
Fryl A T 5: 73,255,609 (GRCm39) S807R probably benign Het
Gaa T A 11: 119,161,207 (GRCm39) D83E probably benign Het
Grm2 A G 9: 106,528,384 (GRCm39) S167P possibly damaging Het
H1f11-ps T C 19: 47,159,129 (GRCm39) K149E unknown Het
Hibch T C 1: 52,892,868 (GRCm39) L26P possibly damaging Het
Hspa9 T C 18: 35,075,084 (GRCm39) E415G probably damaging Het
Ipo4 T C 14: 55,866,408 (GRCm39) Y757C probably damaging Het
Itk T A 11: 46,235,710 (GRCm39) probably benign Het
Kdm5a C T 6: 120,416,092 (GRCm39) P1671S probably benign Het
Kif13a G A 13: 46,951,841 (GRCm39) P811S probably damaging Het
Kif23 T C 9: 61,828,341 (GRCm39) E857G probably damaging Het
Kif2b A G 11: 91,468,011 (GRCm39) S91P probably benign Het
Map2k6 T A 11: 110,388,799 (GRCm39) M247K Het
Mga A G 2: 119,778,070 (GRCm39) I1872V probably benign Het
Mmp15 A T 8: 96,096,316 (GRCm39) N369I probably benign Het
Myo3a T A 2: 22,490,099 (GRCm39) S1487T possibly damaging Het
Ncam1 T C 9: 49,418,736 (GRCm39) T855A Het
Ncoa2 A G 1: 13,223,079 (GRCm39) V1182A probably benign Het
Nhlrc3 A T 3: 53,360,992 (GRCm39) C254* probably null Het
Nlrp1a C T 11: 71,013,819 (GRCm39) R477H probably benign Het
Nox3 T A 17: 3,716,185 (GRCm39) T407S possibly damaging Het
Or1x6 C T 11: 50,939,660 (GRCm39) T242M probably damaging Het
Or3a1d T C 11: 74,237,747 (GRCm39) Y101C probably damaging Het
Or4c15b T A 2: 89,112,676 (GRCm39) D267V probably damaging Het
Pfkp T A 13: 6,655,725 (GRCm39) I303F probably damaging Het
Pgc T C 17: 48,043,983 (GRCm39) Y292H possibly damaging Het
Phtf2 A G 5: 20,999,373 (GRCm39) Y257H probably benign Het
Pkdrej T C 15: 85,701,098 (GRCm39) N1613D probably damaging Het
Prb1b C T 6: 132,289,618 (GRCm39) E69K unknown Het
Rapgef2 A G 3: 78,981,651 (GRCm39) S1115P probably damaging Het
Rbpj A G 5: 53,807,032 (GRCm39) E260G possibly damaging Het
Rrm1 T A 7: 102,109,605 (GRCm39) N476K probably damaging Het
Slc9a2 T A 1: 40,765,612 (GRCm39) I334N probably damaging Het
Slk T G 19: 47,608,512 (GRCm39) N488K probably benign Het
Smarca5 T C 8: 81,440,642 (GRCm39) I607M probably damaging Het
Sspo G A 6: 48,473,087 (GRCm39) V162M probably benign Het
Svep1 T G 4: 58,145,199 (GRCm39) Q422P possibly damaging Het
Tcn2 C T 11: 3,872,111 (GRCm39) V339I probably damaging Het
Tnfrsf19 T C 14: 61,242,650 (GRCm39) H78R probably benign Het
Trav14-3 C A 14: 54,000,887 (GRCm39) Q33K unknown Het
Ubtd2 T C 11: 32,449,432 (GRCm39) I93T possibly damaging Het
Uhrf2 G A 19: 30,066,744 (GRCm39) probably null Het
Vmn1r224 T G 17: 20,640,112 (GRCm39) S230A possibly damaging Het
Wee2 A T 6: 40,421,189 (GRCm39) H93L probably benign Het
Zdhhc17 T C 10: 110,796,934 (GRCm39) E279G probably damaging Het
Zfp623 T A 15: 75,819,349 (GRCm39) F102I probably damaging Het
Zfpm2 A C 15: 40,966,758 (GRCm39) E1081A possibly damaging Het
Zscan18 A T 7: 12,506,116 (GRCm39) probably benign Het
Other mutations in Letm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Letm1 APN 5 33,919,934 (GRCm39) missense possibly damaging 0.82
IGL01073:Letm1 APN 5 33,906,144 (GRCm39) missense possibly damaging 0.89
IGL01882:Letm1 APN 5 33,927,009 (GRCm39) missense probably benign 0.00
IGL02186:Letm1 APN 5 33,902,391 (GRCm39) missense probably benign 0.00
IGL02699:Letm1 APN 5 33,902,492 (GRCm39) missense possibly damaging 0.93
IGL03089:Letm1 APN 5 33,918,202 (GRCm39) missense probably damaging 1.00
R0466:Letm1 UTSW 5 33,919,074 (GRCm39) splice site probably benign
R0639:Letm1 UTSW 5 33,926,770 (GRCm39) missense possibly damaging 0.88
R1370:Letm1 UTSW 5 33,936,026 (GRCm39) splice site probably null
R1415:Letm1 UTSW 5 33,926,906 (GRCm39) missense probably benign 0.06
R1511:Letm1 UTSW 5 33,909,899 (GRCm39) missense probably damaging 1.00
R1714:Letm1 UTSW 5 33,918,228 (GRCm39) missense possibly damaging 0.51
R1771:Letm1 UTSW 5 33,926,811 (GRCm39) missense probably damaging 1.00
R1990:Letm1 UTSW 5 33,926,859 (GRCm39) frame shift probably null
R1991:Letm1 UTSW 5 33,926,859 (GRCm39) frame shift probably null
R2143:Letm1 UTSW 5 33,926,859 (GRCm39) frame shift probably null
R2145:Letm1 UTSW 5 33,926,859 (GRCm39) frame shift probably null
R2202:Letm1 UTSW 5 33,926,830 (GRCm39) missense possibly damaging 0.64
R2290:Letm1 UTSW 5 33,926,859 (GRCm39) frame shift probably null
R2292:Letm1 UTSW 5 33,926,859 (GRCm39) frame shift probably null
R5574:Letm1 UTSW 5 33,926,730 (GRCm39) missense possibly damaging 0.46
R6954:Letm1 UTSW 5 33,939,851 (GRCm39) missense probably benign 0.35
R7265:Letm1 UTSW 5 33,935,992 (GRCm39) missense possibly damaging 0.62
R8713:Letm1 UTSW 5 33,919,849 (GRCm39) missense probably damaging 1.00
R9061:Letm1 UTSW 5 33,918,213 (GRCm39) missense probably damaging 1.00
R9420:Letm1 UTSW 5 33,926,802 (GRCm39) missense probably damaging 1.00
S24628:Letm1 UTSW 5 33,904,790 (GRCm39) missense probably benign
S24628:Letm1 UTSW 5 33,904,788 (GRCm39) missense probably benign 0.00
X0066:Letm1 UTSW 5 33,919,915 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAGATATGCATTTACTTGGG -3'
(R):5'- CCCAGTTGTGTTAACATCAGTGTC -3'

Sequencing Primer
(F):5'- GAGGCTTTTCTAGTTTGAAGACCACC -3'
(R):5'- ACATCAGTGTCATAGATCTGGAATG -3'
Posted On 2021-11-19