Incidental Mutation 'R9028:Dok7'
ID 686863
Institutional Source Beutler Lab
Gene Symbol Dok7
Ensembl Gene ENSMUSG00000044716
Gene Name docking protein 7
Synonyms Dok-7, Oit5, A930013K19Rik, EF-12
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9028 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 35056766-35087839 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 35079475 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 369 (Y369C)
Ref Sequence ENSEMBL: ENSMUSP00000059538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050709] [ENSMUST00000101298] [ENSMUST00000114270]
AlphaFold Q18PE0
Predicted Effect probably damaging
Transcript: ENSMUST00000050709
AA Change: Y369C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000059538
Gene: ENSMUSG00000044716
AA Change: Y369C

DomainStartEndE-ValueType
IRS 73 168 3.15e-26 SMART
low complexity region 212 243 N/A INTRINSIC
low complexity region 279 291 N/A INTRINSIC
low complexity region 306 321 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000101298
AA Change: Y262C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098856
Gene: ENSMUSG00000044716
AA Change: Y262C

DomainStartEndE-ValueType
Blast:PH 5 49 2e-11 BLAST
PDB:3ML4|D 35 76 4e-20 PDB
low complexity region 105 136 N/A INTRINSIC
low complexity region 172 184 N/A INTRINSIC
low complexity region 199 214 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114270
AA Change: Y406C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109909
Gene: ENSMUSG00000044716
AA Change: Y406C

DomainStartEndE-ValueType
PH 5 111 7.9e-3 SMART
IRS 110 205 3.15e-26 SMART
low complexity region 249 280 N/A INTRINSIC
low complexity region 316 328 N/A INTRINSIC
low complexity region 343 358 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is essential for neuromuscular synaptogenesis. The protein functions in aneural activation of muscle-specific receptor kinase, which is required for postsynaptic differentiation, and in the subsequent clustering of the acetylcholine receptor in myotubes. This protein can also induce autophosphorylation of muscle-specific receptor kinase. Mutations in this gene are a cause of familial limb-girdle myasthenia autosomal recessive, which is also known as congenital myasthenic syndrome type 1B. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous mutation of this gene results in death shortly after birth, impaired neuromuscular synaptogenesis and akinesia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik G A 3: 108,463,503 T687I probably benign Het
Aasdh A G 5: 76,876,130 V1066A probably damaging Het
Abca5 T A 11: 110,298,078 H851L probably damaging Het
Actn2 T C 13: 12,300,978 I218M possibly damaging Het
Afmid G A 11: 117,836,663 E338K probably benign Het
Amer3 G A 1: 34,588,677 V666I probably benign Het
Apol7b A G 15: 77,423,416 V293A probably damaging Het
Bag6 T A 17: 35,144,154 S657T probably benign Het
Btaf1 T C 19: 36,969,108 L438P probably damaging Het
Cdc20 T C 4: 118,436,560 E126G probably benign Het
Cep97 C T 16: 55,919,552 W248* probably null Het
Cfap69 A T 5: 5,646,958 S113T probably benign Het
Cgrrf1 C A 14: 46,853,743 D241E probably benign Het
Cnksr1 T C 4: 134,233,297 T280A possibly damaging Het
Cox4i1 T A 8: 120,671,283 probably benign Het
Cpm T A 10: 117,683,509 F441I probably benign Het
Cs A C 10: 128,353,083 M154L Het
Dmrta1 T A 4: 89,691,677 N291K probably damaging Het
Dnah7a T C 1: 53,521,138 T2125A probably benign Het
Dock10 A T 1: 80,606,295 probably benign Het
E130311K13Rik T C 3: 63,915,548 Y225C probably damaging Het
F7 T C 8: 13,026,087 L10P possibly damaging Het
Faf1 C A 4: 109,890,908 T470K possibly damaging Het
Fam83h A T 15: 76,003,889 L533Q possibly damaging Het
Far1 T A 7: 113,547,422 V129E probably damaging Het
Fgfr4 T C 13: 55,159,154 Y219H probably damaging Het
Fryl A T 5: 73,098,266 S807R probably benign Het
Gaa T A 11: 119,270,381 D83E probably benign Het
Gm6970 T C 19: 47,170,690 K149E unknown Het
Grm2 A G 9: 106,651,185 S167P possibly damaging Het
Hibch T C 1: 52,853,709 L26P possibly damaging Het
Hspa9 T C 18: 34,942,031 E415G probably damaging Het
Ipo4 T C 14: 55,628,951 Y757C probably damaging Het
Itk T A 11: 46,344,883 probably benign Het
Kdm5a C T 6: 120,439,131 P1671S probably benign Het
Kif13a G A 13: 46,798,365 P811S probably damaging Het
Kif23 T C 9: 61,921,059 E857G probably damaging Het
Kif2b A G 11: 91,577,185 S91P probably benign Het
Letm1 G T 5: 33,752,503 Q396K probably damaging Het
Map2k6 T A 11: 110,497,973 M247K Het
Mga A G 2: 119,947,589 I1872V probably benign Het
Mmp15 A T 8: 95,369,688 N369I probably benign Het
Myo3a T A 2: 22,600,087 S1487T possibly damaging Het
Ncam1 T C 9: 49,507,436 T855A Het
Ncoa2 A G 1: 13,152,855 V1182A probably benign Het
Nhlrc3 A T 3: 53,453,571 C254* probably null Het
Nlrp1a C T 11: 71,122,993 R477H probably benign Het
Nox3 T A 17: 3,665,910 T407S possibly damaging Het
Olfr1229 T A 2: 89,282,332 D267V probably damaging Het
Olfr1375 C T 11: 51,048,833 T242M probably damaging Het
Olfr411 T C 11: 74,346,921 Y101C probably damaging Het
Pfkp T A 13: 6,605,689 I303F probably damaging Het
Pgc T C 17: 47,733,058 Y292H possibly damaging Het
Phtf2 A G 5: 20,794,375 Y257H probably benign Het
Pkdrej T C 15: 85,816,897 N1613D probably damaging Het
Prpmp5 C T 6: 132,312,655 E69K unknown Het
Rapgef2 A G 3: 79,074,344 S1115P probably damaging Het
Rbpj A G 5: 53,649,690 E260G possibly damaging Het
Rrm1 T A 7: 102,460,398 N476K probably damaging Het
Slc9a2 T A 1: 40,726,452 I334N probably damaging Het
Slk T G 19: 47,620,073 N488K probably benign Het
Smarca5 T C 8: 80,714,013 I607M probably damaging Het
Sspo G A 6: 48,496,153 V162M probably benign Het
Svep1 T G 4: 58,145,199 Q422P possibly damaging Het
Tcn2 C T 11: 3,922,111 V339I probably damaging Het
Tnfrsf19 T C 14: 61,005,201 H78R probably benign Het
Trav14-3 C A 14: 53,763,430 Q33K unknown Het
Ubtd2 T C 11: 32,499,432 I93T possibly damaging Het
Uhrf2 G A 19: 30,089,344 probably null Het
Vmn1r224 T G 17: 20,419,850 S230A possibly damaging Het
Wee2 A T 6: 40,444,255 H93L probably benign Het
Zdhhc17 T C 10: 110,961,073 E279G probably damaging Het
Zfp623 T A 15: 75,947,500 F102I probably damaging Het
Zfpm2 A C 15: 41,103,362 E1081A possibly damaging Het
Zscan18 A T 7: 12,772,189 probably benign Het
Other mutations in Dok7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Dok7 APN 5 35079568 missense possibly damaging 0.49
P0022:Dok7 UTSW 5 35075411 missense probably damaging 1.00
R0255:Dok7 UTSW 5 35064334 missense probably damaging 1.00
R0462:Dok7 UTSW 5 35066462 missense possibly damaging 0.88
R0536:Dok7 UTSW 5 35066482 missense probably damaging 1.00
R0800:Dok7 UTSW 5 35075289 splice site probably benign
R1533:Dok7 UTSW 5 35064327 splice site probably null
R1659:Dok7 UTSW 5 35079139 missense possibly damaging 0.55
R1772:Dok7 UTSW 5 35086650 missense probably damaging 0.98
R1969:Dok7 UTSW 5 35077266 splice site probably null
R4321:Dok7 UTSW 5 35079797 utr 3 prime probably benign
R5864:Dok7 UTSW 5 35066546 missense probably damaging 1.00
R6047:Dok7 UTSW 5 35079307 missense probably damaging 1.00
R6773:Dok7 UTSW 5 35077184 missense probably damaging 1.00
R7003:Dok7 UTSW 5 35079555 missense probably benign 0.06
R7129:Dok7 UTSW 5 35079048 missense probably damaging 1.00
R7326:Dok7 UTSW 5 35064522 missense probably benign 0.11
R7399:Dok7 UTSW 5 35066471 missense probably damaging 1.00
R7712:Dok7 UTSW 5 35066522 missense probably damaging 1.00
R7851:Dok7 UTSW 5 35056936 start codon destroyed probably null 0.04
R8127:Dok7 UTSW 5 35087001 missense probably benign
R8772:Dok7 UTSW 5 35077249 missense probably damaging 1.00
R9272:Dok7 UTSW 5 35056895 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CTCCTCTGACAGTGGCATTG -3'
(R):5'- TCCGCCACAGATTGAACATG -3'

Sequencing Primer
(F):5'- AGGCAGCCACTCCTCTTAC -3'
(R):5'- TGCTTCCCAGGACTCGC -3'
Posted On 2021-11-19