Mutagenetix > Incidental Mutation

Incidental Mutation 'R9028:Fryl'

686865

Institutional Source

Beutler Lab

Gene Symbol

Fryl

Ensembl Gene

ENSMUSG00000070733

Gene Name

FRY like transcription coactivator

Synonyms

2510002A14Rik, 2310004H21Rik, 9030227G01Rik

MMRRC Submission

068857-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.794) question?

Stock #

R9028 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

73019987-73256619 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 73098266 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 807 (S807R)

Ref Sequence

ENSEMBL: ENSMUSP00000098687 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094700] [ENSMUST00000101127]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000094700
AA Change: S807R

PolyPhen 2 Score 0.178 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000092289
Gene: ENSMUSG00000070733
AA Change: S807R

Domain	Start	End	E-Value	Type
Pfam:MOR2-PAG1_N	117	649	5.7e-176	PFAM
low complexity region	873	884	N/A	INTRINSIC
Pfam:MOR2-PAG1_mid	896	1141	1.3e-5	PFAM
Pfam:MOR2-PAG1_mid	1145	1331	2e-19	PFAM
Pfam:MOR2-PAG1_mid	1351	1450	1.2e-5	PFAM
low complexity region	1476	1487	N/A	INTRINSIC
low complexity region	1530	1548	N/A	INTRINSIC
Pfam:MOR2-PAG1_mid	1590	1660	1.1e-5	PFAM
Pfam:MOR2-PAG1_mid	1725	1866	3.2e-15	PFAM
low complexity region	1973	1984	N/A	INTRINSIC
Pfam:MOR2-PAG1_C	2002	2255	9.9e-78	PFAM
low complexity region	2329	2341	N/A	INTRINSIC
low complexity region	2473	2482	N/A	INTRINSIC
low complexity region	2485	2500	N/A	INTRINSIC
low complexity region	2523	2534	N/A	INTRINSIC
coiled coil region	2625	2649	N/A	INTRINSIC
low complexity region	2827	2841	N/A	INTRINSIC
coiled coil region	2854	2893	N/A	INTRINSIC
coiled coil region	2963	2989	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000101127
AA Change: S807R

PolyPhen 2 Score 0.178 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000098687
Gene: ENSMUSG00000070733
AA Change: S807R

Domain	Start	End	E-Value	Type
Pfam:MOR2-PAG1_N	116	649	3e-172	PFAM
low complexity region	873	884	N/A	INTRINSIC
Pfam:MOR2-PAG1_mid	898	1115	7.8e-6	PFAM
Pfam:MOR2-PAG1_mid	1147	1331	9.5e-19	PFAM
Pfam:MOR2-PAG1_mid	1351	1503	1.1e-5	PFAM
low complexity region	1530	1548	N/A	INTRINSIC
Pfam:MOR2-PAG1_mid	1589	1664	6e-6	PFAM
Pfam:MOR2-PAG1_mid	1725	1866	1.6e-14	PFAM
low complexity region	1973	1984	N/A	INTRINSIC
Pfam:MOR2-PAG1_C	1998	2260	4.4e-76	PFAM
low complexity region	2329	2341	N/A	INTRINSIC
low complexity region	2473	2482	N/A	INTRINSIC
low complexity region	2485	2500	N/A	INTRINSIC
low complexity region	2523	2534	N/A	INTRINSIC
coiled coil region	2625	2649	N/A	INTRINSIC
low complexity region	2827	2841	N/A	INTRINSIC
coiled coil region	2854	2893	N/A	INTRINSIC
coiled coil region	2963	2989	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153923

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201405

SMART Domains

Protein: ENSMUSP00000144346
Gene: ENSMUSG00000070733

Domain	Start	End	E-Value	Type
low complexity region	103	114	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

99% (74/75)

MGI Phenotype

PHENOTYPE: Most mice homozygous for a knock-out allele exhibit postnatal lethality and defects in kidney development; rare survivors display growth retardation, decreased body weight, and premature death associated with chronic hydronephrosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5330417C22Rik	G	A	3: 108,463,503	T687I	probably benign	Het
Aasdh	A	G	5: 76,876,130	V1066A	probably damaging	Het
Abca5	T	A	11: 110,298,078	H851L	probably damaging	Het
Actn2	T	C	13: 12,300,978	I218M	possibly damaging	Het
Afmid	G	A	11: 117,836,663	E338K	probably benign	Het
Amer3	G	A	1: 34,588,677	V666I	probably benign	Het
Apol7b	A	G	15: 77,423,416	V293A	probably damaging	Het
Bag6	T	A	17: 35,144,154	S657T	probably benign	Het
Btaf1	T	C	19: 36,969,108	L438P	probably damaging	Het
Cdc20	T	C	4: 118,436,560	E126G	probably benign	Het
Cep97	C	T	16: 55,919,552	W248*	probably null	Het
Cfap69	A	T	5: 5,646,958	S113T	probably benign	Het
Cgrrf1	C	A	14: 46,853,743	D241E	probably benign	Het
Cnksr1	T	C	4: 134,233,297	T280A	possibly damaging	Het
Cox4i1	T	A	8: 120,671,283		probably benign	Het
Cpm	T	A	10: 117,683,509	F441I	probably benign	Het
Cs	A	C	10: 128,353,083	M154L		Het
Dmrta1	T	A	4: 89,691,677	N291K	probably damaging	Het
Dnah7a	T	C	1: 53,521,138	T2125A	probably benign	Het
Dock10	A	T	1: 80,606,295		probably benign	Het
Dok7	A	G	5: 35,079,475	Y369C	probably damaging	Het
E130311K13Rik	T	C	3: 63,915,548	Y225C	probably damaging	Het
F7	T	C	8: 13,026,087	L10P	possibly damaging	Het
Faf1	C	A	4: 109,890,908	T470K	possibly damaging	Het
Fam83h	A	T	15: 76,003,889	L533Q	possibly damaging	Het
Far1	T	A	7: 113,547,422	V129E	probably damaging	Het
Fgfr4	T	C	13: 55,159,154	Y219H	probably damaging	Het
Gaa	T	A	11: 119,270,381	D83E	probably benign	Het
Gm6970	T	C	19: 47,170,690	K149E	unknown	Het
Grm2	A	G	9: 106,651,185	S167P	possibly damaging	Het
Hibch	T	C	1: 52,853,709	L26P	possibly damaging	Het
Hspa9	T	C	18: 34,942,031	E415G	probably damaging	Het
Ipo4	T	C	14: 55,628,951	Y757C	probably damaging	Het
Itk	T	A	11: 46,344,883		probably benign	Het
Kdm5a	C	T	6: 120,439,131	P1671S	probably benign	Het
Kif13a	G	A	13: 46,798,365	P811S	probably damaging	Het
Kif23	T	C	9: 61,921,059	E857G	probably damaging	Het
Kif2b	A	G	11: 91,577,185	S91P	probably benign	Het
Letm1	G	T	5: 33,752,503	Q396K	probably damaging	Het
Map2k6	T	A	11: 110,497,973	M247K		Het
Mga	A	G	2: 119,947,589	I1872V	probably benign	Het
Mmp15	A	T	8: 95,369,688	N369I	probably benign	Het
Myo3a	T	A	2: 22,600,087	S1487T	possibly damaging	Het
Ncam1	T	C	9: 49,507,436	T855A		Het
Ncoa2	A	G	1: 13,152,855	V1182A	probably benign	Het
Nhlrc3	A	T	3: 53,453,571	C254*	probably null	Het
Nlrp1a	C	T	11: 71,122,993	R477H	probably benign	Het
Nox3	T	A	17: 3,665,910	T407S	possibly damaging	Het
Olfr1229	T	A	2: 89,282,332	D267V	probably damaging	Het
Olfr1375	C	T	11: 51,048,833	T242M	probably damaging	Het
Olfr411	T	C	11: 74,346,921	Y101C	probably damaging	Het
Pfkp	T	A	13: 6,605,689	I303F	probably damaging	Het
Pgc	T	C	17: 47,733,058	Y292H	possibly damaging	Het
Phtf2	A	G	5: 20,794,375	Y257H	probably benign	Het
Pkdrej	T	C	15: 85,816,897	N1613D	probably damaging	Het
Prpmp5	C	T	6: 132,312,655	E69K	unknown	Het
Rapgef2	A	G	3: 79,074,344	S1115P	probably damaging	Het
Rbpj	A	G	5: 53,649,690	E260G	possibly damaging	Het
Rrm1	T	A	7: 102,460,398	N476K	probably damaging	Het
Slc9a2	T	A	1: 40,726,452	I334N	probably damaging	Het
Slk	T	G	19: 47,620,073	N488K	probably benign	Het
Smarca5	T	C	8: 80,714,013	I607M	probably damaging	Het
Sspo	G	A	6: 48,496,153	V162M	probably benign	Het
Svep1	T	G	4: 58,145,199	Q422P	possibly damaging	Het
Tcn2	C	T	11: 3,922,111	V339I	probably damaging	Het
Tnfrsf19	T	C	14: 61,005,201	H78R	probably benign	Het
Trav14-3	C	A	14: 53,763,430	Q33K	unknown	Het
Ubtd2	T	C	11: 32,499,432	I93T	possibly damaging	Het
Uhrf2	G	A	19: 30,089,344		probably null	Het
Vmn1r224	T	G	17: 20,419,850	S230A	possibly damaging	Het
Wee2	A	T	6: 40,444,255	H93L	probably benign	Het
Zdhhc17	T	C	10: 110,961,073	E279G	probably damaging	Het
Zfp623	T	A	15: 75,947,500	F102I	probably damaging	Het
Zfpm2	A	C	15: 41,103,362	E1081A	possibly damaging	Het
Zscan18	A	T	7: 12,772,189		probably benign	Het

Other mutations in Fryl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00819:Fryl	APN	5	73148108	missense	possibly damaging	0.92
IGL01518:Fryl	APN	5	73086962	missense	possibly damaging	0.76
IGL01545:Fryl	APN	5	73054597	missense	probably damaging	1.00
IGL01646:Fryl	APN	5	73022501	critical splice donor site	probably null
IGL01938:Fryl	APN	5	73122364	missense	probably damaging	0.98
IGL01962:Fryl	APN	5	73032791	missense	possibly damaging	0.62
IGL02064:Fryl	APN	5	73124769	unclassified	probably benign
IGL02148:Fryl	APN	5	73075959	missense	probably benign	0.35
IGL02418:Fryl	APN	5	73110176	splice site	probably benign
IGL02431:Fryl	APN	5	73098308	missense	probably benign	0.02
IGL02513:Fryl	APN	5	73065293	missense	probably damaging	1.00
IGL02557:Fryl	APN	5	73098393	missense	probably damaging	1.00
IGL02625:Fryl	APN	5	73069877	intron	probably benign
IGL02642:Fryl	APN	5	73095466	missense	probably benign
IGL02657:Fryl	APN	5	73054860	missense	probably benign	0.01
IGL02706:Fryl	APN	5	73093163	missense	probably benign	0.45
IGL03022:Fryl	APN	5	73059383	missense	possibly damaging	0.82
IGL03144:Fryl	APN	5	73101455	missense	probably null	0.22
IGL03155:Fryl	APN	5	73076695	missense	probably benign
IGL03183:Fryl	APN	5	73076695	missense	probably benign
IGL03275:Fryl	APN	5	73148033	missense	possibly damaging	0.47
IGL03310:Fryl	APN	5	73136316	splice site	probably benign
IGL03341:Fryl	APN	5	73076695	missense	probably benign
IGL03343:Fryl	APN	5	73076695	missense	probably benign
IGL03350:Fryl	APN	5	73133306	missense	probably damaging	0.99
IGL03357:Fryl	APN	5	73054059	missense	probably damaging	1.00
IGL03374:Fryl	APN	5	73110281	splice site	probably benign
IGL03375:Fryl	APN	5	73088449	missense	possibly damaging	0.91
bedeviled	UTSW	5	73059500	missense	probably damaging	1.00
Besotted	UTSW	5	73072912	missense	probably damaging	1.00
R0062:Fryl	UTSW	5	73022278	missense	probably benign	0.02
R0062:Fryl	UTSW	5	73022278	missense	probably benign	0.02
R0308:Fryl	UTSW	5	73041604	splice site	probably benign
R0312:Fryl	UTSW	5	73072888	missense	probably damaging	1.00
R0415:Fryl	UTSW	5	73098414	missense	probably damaging	0.99
R0440:Fryl	UTSW	5	73086972	missense	possibly damaging	0.91
R0446:Fryl	UTSW	5	73097417	missense	possibly damaging	0.91
R0566:Fryl	UTSW	5	73064497	splice site	probably benign
R0567:Fryl	UTSW	5	73065391	missense	possibly damaging	0.50
R0606:Fryl	UTSW	5	73124734	missense	probably benign	0.15
R0619:Fryl	UTSW	5	73068731	missense	probably benign	0.22
R0654:Fryl	UTSW	5	73083372	missense	probably benign	0.17
R0658:Fryl	UTSW	5	73065359	missense	probably damaging	1.00
R0707:Fryl	UTSW	5	73083372	missense	probably benign	0.17
R0744:Fryl	UTSW	5	73089081	unclassified	probably benign
R0745:Fryl	UTSW	5	73071126	missense	probably damaging	0.96
R0833:Fryl	UTSW	5	73089081	unclassified	probably benign
R0885:Fryl	UTSW	5	73089196	missense	probably damaging	0.97
R0894:Fryl	UTSW	5	73041332	splice site	probably benign
R1076:Fryl	UTSW	5	73124673	unclassified	probably benign
R1241:Fryl	UTSW	5	73064925	splice site	probably benign
R1241:Fryl	UTSW	5	73110271	missense	probably damaging	1.00
R1394:Fryl	UTSW	5	73072912	missense	probably damaging	1.00
R1395:Fryl	UTSW	5	73072912	missense	probably damaging	1.00
R1608:Fryl	UTSW	5	73074751	nonsense	probably null
R1664:Fryl	UTSW	5	73059435	missense	probably damaging	1.00
R1745:Fryl	UTSW	5	73032861	splice site	probably benign
R1937:Fryl	UTSW	5	73133367	missense	probably damaging	1.00
R1969:Fryl	UTSW	5	73098266	missense	probably benign	0.18
R1993:Fryl	UTSW	5	73108493	missense	probably damaging	1.00
R1994:Fryl	UTSW	5	73108493	missense	probably damaging	1.00
R2029:Fryl	UTSW	5	73022122	nonsense	probably null
R2036:Fryl	UTSW	5	73022544	missense	probably benign
R2036:Fryl	UTSW	5	73107962	critical splice donor site	probably null
R2088:Fryl	UTSW	5	73065461	missense	probably benign	0.02
R2105:Fryl	UTSW	5	73122299	missense	probably benign
R2106:Fryl	UTSW	5	73098331	missense	probably damaging	1.00
R2186:Fryl	UTSW	5	73064975	missense	probably damaging	1.00
R2239:Fryl	UTSW	5	73108547	missense	probably damaging	0.99
R2256:Fryl	UTSW	5	73072844	missense	possibly damaging	0.47
R2257:Fryl	UTSW	5	73072844	missense	possibly damaging	0.47
R2280:Fryl	UTSW	5	73041364	missense	possibly damaging	0.47
R2281:Fryl	UTSW	5	73041364	missense	possibly damaging	0.47
R2911:Fryl	UTSW	5	73050456	missense	probably damaging	0.99
R3019:Fryl	UTSW	5	73082850	missense	probably benign	0.01
R3416:Fryl	UTSW	5	73108074	missense	possibly damaging	0.84
R3783:Fryl	UTSW	5	73101476	missense	probably benign
R3787:Fryl	UTSW	5	73101476	missense	probably benign
R3837:Fryl	UTSW	5	73071265	missense	probably benign	0.03
R3969:Fryl	UTSW	5	73112423	missense	probably damaging	0.97
R4387:Fryl	UTSW	5	73086560	missense	possibly damaging	0.91
R4502:Fryl	UTSW	5	73088397	missense	probably damaging	1.00
R4658:Fryl	UTSW	5	73081053	missense	probably damaging	1.00
R4664:Fryl	UTSW	5	73090679	missense	possibly damaging	0.80
R4690:Fryl	UTSW	5	73100293	missense	probably benign
R4700:Fryl	UTSW	5	73065538	missense	possibly damaging	0.88
R4709:Fryl	UTSW	5	73080972	missense	probably benign	0.03
R4807:Fryl	UTSW	5	73041362	missense	probably benign	0.00
R4912:Fryl	UTSW	5	73068782	frame shift	probably null
R4948:Fryl	UTSW	5	73089130	missense	probably benign	0.08
R4959:Fryl	UTSW	5	73035058	missense	probably benign	0.00
R5062:Fryl	UTSW	5	73075893	missense	possibly damaging	0.89
R5067:Fryl	UTSW	5	73057755	missense	probably benign	0.13
R5071:Fryl	UTSW	5	73074767	missense	probably damaging	0.99
R5072:Fryl	UTSW	5	73074767	missense	probably damaging	0.99
R5073:Fryl	UTSW	5	73074767	missense	probably damaging	0.99
R5074:Fryl	UTSW	5	73074767	missense	probably damaging	0.99
R5139:Fryl	UTSW	5	73090718	missense	probably damaging	1.00
R5172:Fryl	UTSW	5	73101673	missense	possibly damaging	0.95
R5187:Fryl	UTSW	5	73086600	missense	possibly damaging	0.95
R5272:Fryl	UTSW	5	73065136	nonsense	probably null
R5275:Fryl	UTSW	5	73112791	missense	probably damaging	1.00
R5295:Fryl	UTSW	5	73112791	missense	probably damaging	1.00
R5344:Fryl	UTSW	5	73104774	missense	probably damaging	1.00
R5355:Fryl	UTSW	5	73073904	missense	probably damaging	1.00
R5716:Fryl	UTSW	5	73100465	missense	probably benign
R5778:Fryl	UTSW	5	73072778	missense	probably damaging	1.00
R5810:Fryl	UTSW	5	73090755	missense	probably benign	0.06
R5934:Fryl	UTSW	5	73090717	missense	probably damaging	1.00
R5948:Fryl	UTSW	5	73097372	critical splice donor site	probably null
R6005:Fryl	UTSW	5	73083295	missense	probably damaging	1.00
R6026:Fryl	UTSW	5	73099997	missense	probably benign	0.04
R6045:Fryl	UTSW	5	73118551	missense	probably damaging	0.99
R6185:Fryl	UTSW	5	73112788	missense	probably benign	0.43
R6247:Fryl	UTSW	5	73065481	missense	probably damaging	0.98
R6294:Fryl	UTSW	5	73191759	intron	probably benign
R6310:Fryl	UTSW	5	73191761	intron	probably benign
R6429:Fryl	UTSW	5	73090751	missense	possibly damaging	0.84
R6568:Fryl	UTSW	5	73059516	missense	probably damaging	1.00
R6636:Fryl	UTSW	5	73133312	missense	probably benign	0.01
R6664:Fryl	UTSW	5	73132481	missense	probably damaging	1.00
R6732:Fryl	UTSW	5	73054781	missense	probably damaging	1.00
R6750:Fryl	UTSW	5	73022232	missense	probably damaging	1.00
R6805:Fryl	UTSW	5	73065094	missense	probably benign	0.03
R6823:Fryl	UTSW	5	73065217	missense	probably damaging	0.99
R6855:Fryl	UTSW	5	73059500	missense	probably damaging	1.00
R6858:Fryl	UTSW	5	73065032	missense	probably damaging	1.00
R6868:Fryl	UTSW	5	73068803	missense	probably damaging	1.00
R6898:Fryl	UTSW	5	73022142	missense	probably damaging	0.96
R6908:Fryl	UTSW	5	73022211	missense	probably damaging	1.00
R6958:Fryl	UTSW	5	73073929	missense	possibly damaging	0.89
R6980:Fryl	UTSW	5	73050430	missense	probably benign	0.06
R7036:Fryl	UTSW	5	73055608	missense	probably benign	0.03
R7065:Fryl	UTSW	5	73090756	missense	probably damaging	0.96
R7097:Fryl	UTSW	5	73073908	missense	probably benign	0.31
R7171:Fryl	UTSW	5	73122310	missense	probably damaging	0.97
R7191:Fryl	UTSW	5	73072912	missense	probably damaging	1.00
R7207:Fryl	UTSW	5	73065095	missense	probably benign
R7236:Fryl	UTSW	5	73108478	missense	possibly damaging	0.66
R7334:Fryl	UTSW	5	73047496	splice site	probably null
R7425:Fryl	UTSW	5	73104748	missense	probably damaging	1.00
R7452:Fryl	UTSW	5	73023988	missense	probably damaging	1.00
R7479:Fryl	UTSW	5	73097561	missense	possibly damaging	0.71
R7535:Fryl	UTSW	5	73098196	missense	probably benign	0.15
R7538:Fryl	UTSW	5	73022676	missense	probably benign	0.09
R7544:Fryl	UTSW	5	73081039	missense	probably benign
R7548:Fryl	UTSW	5	73191762	missense	unknown
R7565:Fryl	UTSW	5	73033720	missense	probably benign	0.18
R7572:Fryl	UTSW	5	73088396	missense	possibly damaging	0.91
R7582:Fryl	UTSW	5	73022500	critical splice donor site	probably null
R7630:Fryl	UTSW	5	73110245	missense	possibly damaging	0.62
R7774:Fryl	UTSW	5	73083384	missense	probably benign	0.12
R7777:Fryl	UTSW	5	73071298	missense	probably damaging	0.98
R7917:Fryl	UTSW	5	73054532	missense	probably damaging	1.00
R7920:Fryl	UTSW	5	73101807	splice site	probably null
R8110:Fryl	UTSW	5	73133277	missense	probably benign	0.10
R8120:Fryl	UTSW	5	73071184	missense	probably benign	0.01
R8143:Fryl	UTSW	5	73050339	missense	probably benign	0.00
R8207:Fryl	UTSW	5	73100500	splice site	probably null
R8263:Fryl	UTSW	5	73081005	missense	probably damaging	1.00
R8350:Fryl	UTSW	5	73068730	missense	probably benign
R8359:Fryl	UTSW	5	73075933	missense	probably benign	0.39
R8387:Fryl	UTSW	5	73136320	critical splice donor site	probably null
R8403:Fryl	UTSW	5	73118447	makesense	probably null
R8450:Fryl	UTSW	5	73068730	missense	probably benign
R8514:Fryl	UTSW	5	73085356	missense	probably benign
R8536:Fryl	UTSW	5	73100353	missense	probably damaging	0.99
R8703:Fryl	UTSW	5	73090654	missense	probably damaging	0.99
R8708:Fryl	UTSW	5	73132562	missense	probably benign	0.01
R8783:Fryl	UTSW	5	73068842	missense	probably benign	0.45
R9045:Fryl	UTSW	5	73024775	missense
R9063:Fryl	UTSW	5	73081003	missense	possibly damaging	0.70
R9096:Fryl	UTSW	5	73108577	missense	probably benign	0.01
R9244:Fryl	UTSW	5	73191519	intron	probably benign
R9345:Fryl	UTSW	5	73050411	missense	probably benign
R9381:Fryl	UTSW	5	73083294	missense	probably benign	0.24
R9386:Fryl	UTSW	5	73191809	missense	unknown
R9401:Fryl	UTSW	5	73065220	nonsense	probably null
R9497:Fryl	UTSW	5	73057791	missense
R9514:Fryl	UTSW	5	73104772	missense	probably damaging	1.00
R9570:Fryl	UTSW	5	73022155	missense	probably benign	0.02
R9654:Fryl	UTSW	5	73118458	missense	probably benign
R9665:Fryl	UTSW	5	73064956	missense	probably damaging	1.00
R9685:Fryl	UTSW	5	73059536	missense	probably damaging	0.99
R9798:Fryl	UTSW	5	73035059	missense	probably benign
Z1088:Fryl	UTSW	5	73090709	missense	probably damaging	0.99
Z1088:Fryl	UTSW	5	73090738	missense	probably damaging	1.00
Z1176:Fryl	UTSW	5	73072837	missense	probably benign
Z1177:Fryl	UTSW	5	73041595	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- GAGAATTTCCAGTGTGTGCC -3'
(R):5'- ATGCGTGATAATCATTTGTGCGC -3'

Sequencing Primer
(F):5'- GTGTGTGCCACTTTTCAAAAGCAC -3'
(R):5'- GTGATAATCATTTGTGCGCTCTCTC -3'

Posted On

2021-11-19