Incidental Mutation 'R9028:Aasdh'
ID 686866
Institutional Source Beutler Lab
Gene Symbol Aasdh
Ensembl Gene ENSMUSG00000055923
Gene Name aminoadipate-semialdehyde dehydrogenase
Synonyms A230062G08Rik
MMRRC Submission 068857-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.159) question?
Stock # R9028 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 77021506-77053361 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 77023977 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1066 (V1066A)
Ref Sequence ENSEMBL: ENSMUSP00000113792 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069709] [ENSMUST00000120639] [ENSMUST00000120963] [ENSMUST00000121160] [ENSMUST00000123682] [ENSMUST00000126741] [ENSMUST00000149602] [ENSMUST00000163347]
AlphaFold Q80WC9
Predicted Effect probably damaging
Transcript: ENSMUST00000069709
AA Change: V1066A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000069279
Gene: ENSMUSG00000055923
AA Change: V1066A

DomainStartEndE-ValueType
Pfam:AMP-binding 7 449 1.3e-50 PFAM
Pfam:AMP-binding_C 458 526 7.4e-6 PFAM
Pfam:PP-binding 556 628 1.2e-6 PFAM
PQQ 775 808 5.29e-1 SMART
PQQ 818 850 4.37e-2 SMART
PQQ 860 892 2.3e1 SMART
PQQ 901 934 2.83e1 SMART
Blast:PQQ 943 973 2e-9 BLAST
PQQ 982 1014 2.61e2 SMART
PQQ 1029 1061 8.53e0 SMART
Blast:PQQ 1070 1100 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000120639
SMART Domains Protein: ENSMUSP00000113796
Gene: ENSMUSG00000036377

DomainStartEndE-ValueType
Pfam:DUF4592 44 173 1.7e-45 PFAM
low complexity region 210 220 N/A INTRINSIC
coiled coil region 224 291 N/A INTRINSIC
coiled coil region 328 482 N/A INTRINSIC
low complexity region 533 547 N/A INTRINSIC
low complexity region 580 593 N/A INTRINSIC
low complexity region 875 888 N/A INTRINSIC
internal_repeat_1 947 1025 1.47e-5 PROSPERO
low complexity region 1034 1047 N/A INTRINSIC
internal_repeat_1 1065 1122 1.47e-5 PROSPERO
low complexity region 1268 1280 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120963
AA Change: V1066A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113792
Gene: ENSMUSG00000055923
AA Change: V1066A

DomainStartEndE-ValueType
Pfam:AMP-binding 7 449 1.3e-50 PFAM
Pfam:AMP-binding_C 458 526 7.4e-6 PFAM
Pfam:PP-binding 556 628 1.2e-6 PFAM
PQQ 775 808 5.29e-1 SMART
PQQ 818 850 4.37e-2 SMART
PQQ 860 892 2.3e1 SMART
PQQ 901 934 2.83e1 SMART
Blast:PQQ 943 973 2e-9 BLAST
PQQ 982 1014 2.61e2 SMART
PQQ 1029 1061 8.53e0 SMART
Blast:PQQ 1070 1100 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000121160
SMART Domains Protein: ENSMUSP00000113947
Gene: ENSMUSG00000036377

DomainStartEndE-ValueType
Pfam:DUF4592 45 172 1.8e-41 PFAM
low complexity region 210 220 N/A INTRINSIC
coiled coil region 224 291 N/A INTRINSIC
coiled coil region 328 482 N/A INTRINSIC
low complexity region 533 547 N/A INTRINSIC
low complexity region 580 593 N/A INTRINSIC
low complexity region 875 888 N/A INTRINSIC
low complexity region 1034 1047 N/A INTRINSIC
low complexity region 1271 1283 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123682
SMART Domains Protein: ENSMUSP00000121050
Gene: ENSMUSG00000055923

DomainStartEndE-ValueType
Pfam:AMP-binding 7 231 1.7e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126741
SMART Domains Protein: ENSMUSP00000118854
Gene: ENSMUSG00000055923

DomainStartEndE-ValueType
Pfam:AMP-binding 7 403 7.5e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149602
SMART Domains Protein: ENSMUSP00000117489
Gene: ENSMUSG00000055923

DomainStartEndE-ValueType
PQQ 21 53 4.37e-2 SMART
PQQ 63 95 2.3e1 SMART
Blast:PQQ 104 130 2e-6 BLAST
PQQ 141 173 2.61e2 SMART
low complexity region 191 200 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163347
SMART Domains Protein: ENSMUSP00000127212
Gene: ENSMUSG00000036377

DomainStartEndE-ValueType
Pfam:DUF4592 44 173 1.7e-45 PFAM
low complexity region 210 220 N/A INTRINSIC
coiled coil region 224 291 N/A INTRINSIC
coiled coil region 328 482 N/A INTRINSIC
low complexity region 533 547 N/A INTRINSIC
low complexity region 580 593 N/A INTRINSIC
low complexity region 875 888 N/A INTRINSIC
internal_repeat_1 947 1025 1.47e-5 PROSPERO
low complexity region 1034 1047 N/A INTRINSIC
internal_repeat_1 1065 1122 1.47e-5 PROSPERO
low complexity region 1268 1280 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: The gene product is a cytosolic enzyme involved in the production of alpha-aminoadipic acid from alpha-aminoadipic semialdehyde. It is postulated that this enzyme plays a role in lysine metabolism. There is currently debate regarding this enzyme's putative requirement of pyrroloquinoline quinine as an essential cofactor. A related pseudogene has been identified on chromosome 2. [provided by RefSeq, Jan 2010]
Allele List at MGI

All alleles(14) : Gene trapped(14)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 T A 11: 110,188,904 (GRCm39) H851L probably damaging Het
Actn2 T C 13: 12,315,864 (GRCm39) I218M possibly damaging Het
Afmid G A 11: 117,727,489 (GRCm39) E338K probably benign Het
Amer3 G A 1: 34,627,758 (GRCm39) V666I probably benign Het
Apol7b A G 15: 77,307,616 (GRCm39) V293A probably damaging Het
Bag6 T A 17: 35,363,130 (GRCm39) S657T probably benign Het
Btaf1 T C 19: 36,946,508 (GRCm39) L438P probably damaging Het
Cdc20 T C 4: 118,293,757 (GRCm39) E126G probably benign Het
Cep97 C T 16: 55,739,915 (GRCm39) W248* probably null Het
Cfap69 A T 5: 5,696,958 (GRCm39) S113T probably benign Het
Cgrrf1 C A 14: 47,091,200 (GRCm39) D241E probably benign Het
Cnksr1 T C 4: 133,960,608 (GRCm39) T280A possibly damaging Het
Cox4i1 T A 8: 121,398,022 (GRCm39) probably benign Het
Cpm T A 10: 117,519,414 (GRCm39) F441I probably benign Het
Cs A C 10: 128,188,952 (GRCm39) M154L Het
Dmrta1 T A 4: 89,579,914 (GRCm39) N291K probably damaging Het
Dnah7a T C 1: 53,560,297 (GRCm39) T2125A probably benign Het
Dock10 A T 1: 80,584,012 (GRCm39) probably benign Het
Dok7 A G 5: 35,236,819 (GRCm39) Y369C probably damaging Het
E130311K13Rik T C 3: 63,822,969 (GRCm39) Y225C probably damaging Het
Elapor1 G A 3: 108,370,819 (GRCm39) T687I probably benign Het
F7 T C 8: 13,076,087 (GRCm39) L10P possibly damaging Het
Faf1 C A 4: 109,748,105 (GRCm39) T470K possibly damaging Het
Fam83h A T 15: 75,875,738 (GRCm39) L533Q possibly damaging Het
Far1 T A 7: 113,146,629 (GRCm39) V129E probably damaging Het
Fgfr4 T C 13: 55,306,967 (GRCm39) Y219H probably damaging Het
Fryl A T 5: 73,255,609 (GRCm39) S807R probably benign Het
Gaa T A 11: 119,161,207 (GRCm39) D83E probably benign Het
Grm2 A G 9: 106,528,384 (GRCm39) S167P possibly damaging Het
H1f11-ps T C 19: 47,159,129 (GRCm39) K149E unknown Het
Hibch T C 1: 52,892,868 (GRCm39) L26P possibly damaging Het
Hspa9 T C 18: 35,075,084 (GRCm39) E415G probably damaging Het
Ipo4 T C 14: 55,866,408 (GRCm39) Y757C probably damaging Het
Itk T A 11: 46,235,710 (GRCm39) probably benign Het
Kdm5a C T 6: 120,416,092 (GRCm39) P1671S probably benign Het
Kif13a G A 13: 46,951,841 (GRCm39) P811S probably damaging Het
Kif23 T C 9: 61,828,341 (GRCm39) E857G probably damaging Het
Kif2b A G 11: 91,468,011 (GRCm39) S91P probably benign Het
Letm1 G T 5: 33,909,847 (GRCm39) Q396K probably damaging Het
Map2k6 T A 11: 110,388,799 (GRCm39) M247K Het
Mga A G 2: 119,778,070 (GRCm39) I1872V probably benign Het
Mmp15 A T 8: 96,096,316 (GRCm39) N369I probably benign Het
Myo3a T A 2: 22,490,099 (GRCm39) S1487T possibly damaging Het
Ncam1 T C 9: 49,418,736 (GRCm39) T855A Het
Ncoa2 A G 1: 13,223,079 (GRCm39) V1182A probably benign Het
Nhlrc3 A T 3: 53,360,992 (GRCm39) C254* probably null Het
Nlrp1a C T 11: 71,013,819 (GRCm39) R477H probably benign Het
Nox3 T A 17: 3,716,185 (GRCm39) T407S possibly damaging Het
Or1x6 C T 11: 50,939,660 (GRCm39) T242M probably damaging Het
Or3a1d T C 11: 74,237,747 (GRCm39) Y101C probably damaging Het
Or4c15b T A 2: 89,112,676 (GRCm39) D267V probably damaging Het
Pfkp T A 13: 6,655,725 (GRCm39) I303F probably damaging Het
Pgc T C 17: 48,043,983 (GRCm39) Y292H possibly damaging Het
Phtf2 A G 5: 20,999,373 (GRCm39) Y257H probably benign Het
Pkdrej T C 15: 85,701,098 (GRCm39) N1613D probably damaging Het
Prb1b C T 6: 132,289,618 (GRCm39) E69K unknown Het
Rapgef2 A G 3: 78,981,651 (GRCm39) S1115P probably damaging Het
Rbpj A G 5: 53,807,032 (GRCm39) E260G possibly damaging Het
Rrm1 T A 7: 102,109,605 (GRCm39) N476K probably damaging Het
Slc9a2 T A 1: 40,765,612 (GRCm39) I334N probably damaging Het
Slk T G 19: 47,608,512 (GRCm39) N488K probably benign Het
Smarca5 T C 8: 81,440,642 (GRCm39) I607M probably damaging Het
Sspo G A 6: 48,473,087 (GRCm39) V162M probably benign Het
Svep1 T G 4: 58,145,199 (GRCm39) Q422P possibly damaging Het
Tcn2 C T 11: 3,872,111 (GRCm39) V339I probably damaging Het
Tnfrsf19 T C 14: 61,242,650 (GRCm39) H78R probably benign Het
Trav14-3 C A 14: 54,000,887 (GRCm39) Q33K unknown Het
Ubtd2 T C 11: 32,449,432 (GRCm39) I93T possibly damaging Het
Uhrf2 G A 19: 30,066,744 (GRCm39) probably null Het
Vmn1r224 T G 17: 20,640,112 (GRCm39) S230A possibly damaging Het
Wee2 A T 6: 40,421,189 (GRCm39) H93L probably benign Het
Zdhhc17 T C 10: 110,796,934 (GRCm39) E279G probably damaging Het
Zfp623 T A 15: 75,819,349 (GRCm39) F102I probably damaging Het
Zfpm2 A C 15: 40,966,758 (GRCm39) E1081A possibly damaging Het
Zscan18 A T 7: 12,506,116 (GRCm39) probably benign Het
Other mutations in Aasdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Aasdh APN 5 77,026,381 (GRCm39) unclassified probably benign
IGL01013:Aasdh APN 5 77,034,053 (GRCm39) missense possibly damaging 0.68
IGL01558:Aasdh APN 5 77,036,464 (GRCm39) missense possibly damaging 0.89
IGL02544:Aasdh APN 5 77,049,961 (GRCm39) missense probably benign 0.27
IGL02614:Aasdh APN 5 77,044,215 (GRCm39) splice site probably benign
IGL02678:Aasdh APN 5 77,035,867 (GRCm39) splice site probably benign
IGL02739:Aasdh APN 5 77,026,364 (GRCm39) missense possibly damaging 0.64
IGL02947:Aasdh APN 5 77,049,957 (GRCm39) missense probably benign 0.01
IGL03116:Aasdh APN 5 77,049,936 (GRCm39) splice site probably null
IGL03398:Aasdh APN 5 77,039,566 (GRCm39) missense probably benign 0.02
1mM(1):Aasdh UTSW 5 77,044,464 (GRCm39) missense possibly damaging 0.91
R0183:Aasdh UTSW 5 77,034,082 (GRCm39) missense probably benign 0.05
R0226:Aasdh UTSW 5 77,049,849 (GRCm39) missense probably damaging 1.00
R0367:Aasdh UTSW 5 77,049,961 (GRCm39) missense probably damaging 0.99
R0386:Aasdh UTSW 5 77,044,308 (GRCm39) missense probably damaging 0.98
R0529:Aasdh UTSW 5 77,024,114 (GRCm39) nonsense probably null
R0881:Aasdh UTSW 5 77,024,130 (GRCm39) missense probably damaging 1.00
R0882:Aasdh UTSW 5 77,024,130 (GRCm39) missense probably damaging 1.00
R1033:Aasdh UTSW 5 77,024,130 (GRCm39) missense probably damaging 1.00
R1034:Aasdh UTSW 5 77,024,130 (GRCm39) missense probably damaging 1.00
R1035:Aasdh UTSW 5 77,024,130 (GRCm39) missense probably damaging 1.00
R1036:Aasdh UTSW 5 77,024,130 (GRCm39) missense probably damaging 1.00
R1366:Aasdh UTSW 5 77,036,651 (GRCm39) missense probably benign 0.10
R1446:Aasdh UTSW 5 77,034,136 (GRCm39) missense probably benign 0.45
R1449:Aasdh UTSW 5 77,034,136 (GRCm39) missense probably benign 0.45
R1469:Aasdh UTSW 5 77,039,526 (GRCm39) missense probably damaging 0.97
R1469:Aasdh UTSW 5 77,039,526 (GRCm39) missense probably damaging 0.97
R1583:Aasdh UTSW 5 77,030,528 (GRCm39) missense probably benign 0.00
R1641:Aasdh UTSW 5 77,039,626 (GRCm39) missense probably benign 0.36
R1876:Aasdh UTSW 5 77,025,396 (GRCm39) missense probably damaging 1.00
R1895:Aasdh UTSW 5 77,039,551 (GRCm39) missense probably damaging 1.00
R1946:Aasdh UTSW 5 77,039,551 (GRCm39) missense probably damaging 1.00
R3615:Aasdh UTSW 5 77,036,629 (GRCm39) missense probably benign 0.20
R3616:Aasdh UTSW 5 77,036,629 (GRCm39) missense probably benign 0.20
R3746:Aasdh UTSW 5 77,036,501 (GRCm39) nonsense probably null
R3747:Aasdh UTSW 5 77,036,501 (GRCm39) nonsense probably null
R3748:Aasdh UTSW 5 77,036,501 (GRCm39) nonsense probably null
R3750:Aasdh UTSW 5 77,036,501 (GRCm39) nonsense probably null
R3836:Aasdh UTSW 5 77,026,315 (GRCm39) missense probably benign 0.32
R4857:Aasdh UTSW 5 77,035,131 (GRCm39) missense probably benign 0.01
R4928:Aasdh UTSW 5 77,044,535 (GRCm39) missense possibly damaging 0.65
R4937:Aasdh UTSW 5 77,036,501 (GRCm39) nonsense probably null
R5762:Aasdh UTSW 5 77,044,445 (GRCm39) missense probably benign 0.00
R5866:Aasdh UTSW 5 77,024,058 (GRCm39) missense probably damaging 1.00
R5940:Aasdh UTSW 5 77,030,745 (GRCm39) missense probably benign 0.07
R6253:Aasdh UTSW 5 77,034,105 (GRCm39) missense possibly damaging 0.81
R6542:Aasdh UTSW 5 77,030,902 (GRCm39) missense probably damaging 1.00
R6825:Aasdh UTSW 5 77,036,696 (GRCm39) splice site probably null
R6868:Aasdh UTSW 5 77,039,527 (GRCm39) missense probably damaging 0.99
R6876:Aasdh UTSW 5 77,044,288 (GRCm39) missense probably damaging 1.00
R6961:Aasdh UTSW 5 77,024,148 (GRCm39) missense probably damaging 1.00
R6963:Aasdh UTSW 5 77,044,303 (GRCm39) missense probably damaging 0.99
R7069:Aasdh UTSW 5 77,024,203 (GRCm39) missense probably benign 0.03
R7220:Aasdh UTSW 5 77,049,772 (GRCm39) missense probably benign 0.13
R7545:Aasdh UTSW 5 77,027,861 (GRCm39) missense probably damaging 1.00
R7673:Aasdh UTSW 5 77,030,555 (GRCm39) missense probably benign 0.03
R7703:Aasdh UTSW 5 77,035,924 (GRCm39) missense probably damaging 0.99
R7890:Aasdh UTSW 5 77,031,969 (GRCm39) missense probably benign 0.19
R7978:Aasdh UTSW 5 77,036,515 (GRCm39) missense probably damaging 0.99
R8046:Aasdh UTSW 5 77,044,325 (GRCm39) missense probably benign
R8152:Aasdh UTSW 5 77,044,305 (GRCm39) missense probably damaging 1.00
R8425:Aasdh UTSW 5 77,034,124 (GRCm39) missense possibly damaging 0.49
R8884:Aasdh UTSW 5 77,039,641 (GRCm39) missense possibly damaging 0.94
R9361:Aasdh UTSW 5 77,030,225 (GRCm39) missense probably benign 0.01
R9519:Aasdh UTSW 5 77,030,572 (GRCm39) missense probably benign 0.00
Z1088:Aasdh UTSW 5 77,049,004 (GRCm39) splice site probably null
Z1176:Aasdh UTSW 5 77,039,643 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CTGCTCTCTATGGAAAGGACC -3'
(R):5'- ACCTCCGGTGGAAATTTGAG -3'

Sequencing Primer
(F):5'- GCTCTCTATGGAAAGGACCACAGAC -3'
(R):5'- CTCCGGTGGAAATTTGAGACGAC -3'
Posted On 2021-11-19