Incidental Mutation 'R9028:Aasdh'
ID686866
Institutional Source Beutler Lab
Gene Symbol Aasdh
Ensembl Gene ENSMUSG00000055923
Gene Nameaminoadipate-semialdehyde dehydrogenase
SynonymsA230062G08Rik
Accession Numbers

Genbank: NM_173765.3; Ensembl: ENSMUST00000120963

Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R9028 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location76873659-76905514 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76876130 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1066 (V1066A)
Ref Sequence ENSEMBL: ENSMUSP00000113792 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069709] [ENSMUST00000120639] [ENSMUST00000120963] [ENSMUST00000121160] [ENSMUST00000123682] [ENSMUST00000126741] [ENSMUST00000149602] [ENSMUST00000163347]
AlphaFold Q80WC9
Predicted Effect probably damaging
Transcript: ENSMUST00000069709
AA Change: V1066A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000069279
Gene: ENSMUSG00000055923
AA Change: V1066A

DomainStartEndE-ValueType
Pfam:AMP-binding 7 449 1.3e-50 PFAM
Pfam:AMP-binding_C 458 526 7.4e-6 PFAM
Pfam:PP-binding 556 628 1.2e-6 PFAM
PQQ 775 808 5.29e-1 SMART
PQQ 818 850 4.37e-2 SMART
PQQ 860 892 2.3e1 SMART
PQQ 901 934 2.83e1 SMART
Blast:PQQ 943 973 2e-9 BLAST
PQQ 982 1014 2.61e2 SMART
PQQ 1029 1061 8.53e0 SMART
Blast:PQQ 1070 1100 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000120639
SMART Domains Protein: ENSMUSP00000113796
Gene: ENSMUSG00000036377

DomainStartEndE-ValueType
Pfam:DUF4592 44 173 1.7e-45 PFAM
low complexity region 210 220 N/A INTRINSIC
coiled coil region 224 291 N/A INTRINSIC
coiled coil region 328 482 N/A INTRINSIC
low complexity region 533 547 N/A INTRINSIC
low complexity region 580 593 N/A INTRINSIC
low complexity region 875 888 N/A INTRINSIC
internal_repeat_1 947 1025 1.47e-5 PROSPERO
low complexity region 1034 1047 N/A INTRINSIC
internal_repeat_1 1065 1122 1.47e-5 PROSPERO
low complexity region 1268 1280 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120963
AA Change: V1066A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113792
Gene: ENSMUSG00000055923
AA Change: V1066A

DomainStartEndE-ValueType
Pfam:AMP-binding 7 449 1.3e-50 PFAM
Pfam:AMP-binding_C 458 526 7.4e-6 PFAM
Pfam:PP-binding 556 628 1.2e-6 PFAM
PQQ 775 808 5.29e-1 SMART
PQQ 818 850 4.37e-2 SMART
PQQ 860 892 2.3e1 SMART
PQQ 901 934 2.83e1 SMART
Blast:PQQ 943 973 2e-9 BLAST
PQQ 982 1014 2.61e2 SMART
PQQ 1029 1061 8.53e0 SMART
Blast:PQQ 1070 1100 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000121160
SMART Domains Protein: ENSMUSP00000113947
Gene: ENSMUSG00000036377

DomainStartEndE-ValueType
Pfam:DUF4592 45 172 1.8e-41 PFAM
low complexity region 210 220 N/A INTRINSIC
coiled coil region 224 291 N/A INTRINSIC
coiled coil region 328 482 N/A INTRINSIC
low complexity region 533 547 N/A INTRINSIC
low complexity region 580 593 N/A INTRINSIC
low complexity region 875 888 N/A INTRINSIC
low complexity region 1034 1047 N/A INTRINSIC
low complexity region 1271 1283 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123682
SMART Domains Protein: ENSMUSP00000121050
Gene: ENSMUSG00000055923

DomainStartEndE-ValueType
Pfam:AMP-binding 7 231 1.7e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126741
SMART Domains Protein: ENSMUSP00000118854
Gene: ENSMUSG00000055923

DomainStartEndE-ValueType
Pfam:AMP-binding 7 403 7.5e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149602
SMART Domains Protein: ENSMUSP00000117489
Gene: ENSMUSG00000055923

DomainStartEndE-ValueType
PQQ 21 53 4.37e-2 SMART
PQQ 63 95 2.3e1 SMART
Blast:PQQ 104 130 2e-6 BLAST
PQQ 141 173 2.61e2 SMART
low complexity region 191 200 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163347
SMART Domains Protein: ENSMUSP00000127212
Gene: ENSMUSG00000036377

DomainStartEndE-ValueType
Pfam:DUF4592 44 173 1.7e-45 PFAM
low complexity region 210 220 N/A INTRINSIC
coiled coil region 224 291 N/A INTRINSIC
coiled coil region 328 482 N/A INTRINSIC
low complexity region 533 547 N/A INTRINSIC
low complexity region 580 593 N/A INTRINSIC
low complexity region 875 888 N/A INTRINSIC
internal_repeat_1 947 1025 1.47e-5 PROSPERO
low complexity region 1034 1047 N/A INTRINSIC
internal_repeat_1 1065 1122 1.47e-5 PROSPERO
low complexity region 1268 1280 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: The gene product is a cytosolic enzyme involved in the production of alpha-aminoadipic acid from alpha-aminoadipic semialdehyde. It is postulated that this enzyme plays a role in lysine metabolism. There is currently debate regarding this enzyme's putative requirement of pyrroloquinoline quinine as an essential cofactor. A related pseudogene has been identified on chromosome 2. [provided by RefSeq, Jan 2010]
Allele List at MGI

All alleles(14) : Gene trapped(14)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik G A 3: 108,463,503 T687I probably benign Het
Abca5 T A 11: 110,298,078 H851L probably damaging Het
Actn2 T C 13: 12,300,978 I218M possibly damaging Het
Afmid G A 11: 117,836,663 E338K probably benign Het
Amer3 G A 1: 34,588,677 V666I probably benign Het
Apol7b A G 15: 77,423,416 V293A probably damaging Het
Bag6 T A 17: 35,144,154 S657T probably benign Het
Btaf1 T C 19: 36,969,108 L438P probably damaging Het
Cdc20 T C 4: 118,436,560 E126G probably benign Het
Cep97 C T 16: 55,919,552 W248* probably null Het
Cfap69 A T 5: 5,646,958 S113T probably benign Het
Cgrrf1 C A 14: 46,853,743 D241E probably benign Het
Cnksr1 T C 4: 134,233,297 T280A possibly damaging Het
Cpm T A 10: 117,683,509 F441I probably benign Het
Cs A C 10: 128,353,083 M154L Het
Dmrta1 T A 4: 89,691,677 N291K probably damaging Het
Dnah7a T C 1: 53,521,138 T2125A probably benign Het
Dok7 A G 5: 35,079,475 Y369C probably damaging Het
E130311K13Rik T C 3: 63,915,548 Y225C probably damaging Het
F7 T C 8: 13,026,087 L10P possibly damaging Het
Faf1 C A 4: 109,890,908 T470K possibly damaging Het
Fam83h A T 15: 76,003,889 L533Q possibly damaging Het
Far1 T A 7: 113,547,422 V129E probably damaging Het
Fgfr4 T C 13: 55,159,154 Y219H probably damaging Het
Fryl A T 5: 73,098,266 S807R probably benign Het
Gaa T A 11: 119,270,381 D83E probably benign Het
Gm6970 T C 19: 47,170,690 K149E unknown Het
Grm2 A G 9: 106,651,185 S167P possibly damaging Het
Hibch T C 1: 52,853,709 L26P possibly damaging Het
Hspa9 T C 18: 34,942,031 E415G probably damaging Het
Ipo4 T C 14: 55,628,951 Y757C probably damaging Het
Kdm5a C T 6: 120,439,131 P1671S probably benign Het
Kif13a G A 13: 46,798,365 P811S probably damaging Het
Kif23 T C 9: 61,921,059 E857G probably damaging Het
Kif2b A G 11: 91,577,185 S91P probably benign Het
Letm1 G T 5: 33,752,503 Q396K probably damaging Het
Map2k6 T A 11: 110,497,973 M247K Het
Mga A G 2: 119,947,589 I1872V probably benign Het
Mmp15 A T 8: 95,369,688 N369I probably benign Het
Myo3a T A 2: 22,600,087 S1487T possibly damaging Het
Ncam1 T C 9: 49,507,436 T855A Het
Ncoa2 A G 1: 13,152,855 V1182A probably benign Het
Nhlrc3 A T 3: 53,453,571 C254* probably null Het
Nlrp1a C T 11: 71,122,993 R477H probably benign Het
Nox3 T A 17: 3,665,910 T407S possibly damaging Het
Olfr1229 T A 2: 89,282,332 D267V probably damaging Het
Olfr1375 C T 11: 51,048,833 T242M probably damaging Het
Olfr411 T C 11: 74,346,921 Y101C probably damaging Het
Pfkp T A 13: 6,605,689 I303F probably damaging Het
Pgc T C 17: 47,733,058 Y292H possibly damaging Het
Phtf2 A G 5: 20,794,375 Y257H probably benign Het
Pkdrej T C 15: 85,816,897 N1613D probably damaging Het
Prpmp5 C T 6: 132,312,655 E69K unknown Het
Rapgef2 A G 3: 79,074,344 S1115P probably damaging Het
Rbpj A G 5: 53,649,690 E260G possibly damaging Het
Rrm1 T A 7: 102,460,398 N476K probably damaging Het
Slc9a2 T A 1: 40,726,452 I334N probably damaging Het
Slk T G 19: 47,620,073 N488K probably benign Het
Smarca5 T C 8: 80,714,013 I607M probably damaging Het
Sspo G A 6: 48,496,153 V162M probably benign Het
Svep1 T G 4: 58,145,199 Q422P possibly damaging Het
Tcn2 C T 11: 3,922,111 V339I probably damaging Het
Tnfrsf19 T C 14: 61,005,201 H78R probably benign Het
Trav14-3 C A 14: 53,763,430 Q33K unknown Het
Ubtd2 T C 11: 32,499,432 I93T possibly damaging Het
Uhrf2 G A 19: 30,089,344 probably null Het
Vmn1r224 T G 17: 20,419,850 S230A possibly damaging Het
Wee2 A T 6: 40,444,255 H93L probably benign Het
Zdhhc17 T C 10: 110,961,073 E279G probably damaging Het
Zfp623 T A 15: 75,947,500 F102I probably damaging Het
Zfpm2 A C 15: 41,103,362 E1081A possibly damaging Het
Other mutations in Aasdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Aasdh APN 5 76878534 unclassified probably benign
IGL01013:Aasdh APN 5 76886206 missense possibly damaging 0.68
IGL01558:Aasdh APN 5 76888617 missense possibly damaging 0.89
IGL02544:Aasdh APN 5 76902114 missense probably benign 0.27
IGL02614:Aasdh APN 5 76896368 splice site probably benign
IGL02678:Aasdh APN 5 76888020 splice site probably benign
IGL02739:Aasdh APN 5 76878517 missense possibly damaging 0.64
IGL02947:Aasdh APN 5 76902110 missense probably benign 0.01
IGL03116:Aasdh APN 5 76902089 splice site probably null
IGL03398:Aasdh APN 5 76891719 missense probably benign 0.02
1mM(1):Aasdh UTSW 5 76896617 missense possibly damaging 0.91
R0183:Aasdh UTSW 5 76886235 missense probably benign 0.05
R0226:Aasdh UTSW 5 76902002 missense probably damaging 1.00
R0367:Aasdh UTSW 5 76902114 missense probably damaging 0.99
R0386:Aasdh UTSW 5 76896461 missense probably damaging 0.98
R0529:Aasdh UTSW 5 76876267 nonsense probably null
R0881:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R0882:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R1033:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R1034:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R1035:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R1036:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R1366:Aasdh UTSW 5 76888804 missense probably benign 0.10
R1446:Aasdh UTSW 5 76886289 missense probably benign 0.45
R1449:Aasdh UTSW 5 76886289 missense probably benign 0.45
R1469:Aasdh UTSW 5 76891679 missense probably damaging 0.97
R1469:Aasdh UTSW 5 76891679 missense probably damaging 0.97
R1583:Aasdh UTSW 5 76882681 missense probably benign 0.00
R1641:Aasdh UTSW 5 76891779 missense probably benign 0.36
R1876:Aasdh UTSW 5 76877549 missense probably damaging 1.00
R1895:Aasdh UTSW 5 76891704 missense probably damaging 1.00
R1946:Aasdh UTSW 5 76891704 missense probably damaging 1.00
R3615:Aasdh UTSW 5 76888782 missense probably benign 0.20
R3616:Aasdh UTSW 5 76888782 missense probably benign 0.20
R3746:Aasdh UTSW 5 76888654 nonsense probably null
R3747:Aasdh UTSW 5 76888654 nonsense probably null
R3748:Aasdh UTSW 5 76888654 nonsense probably null
R3750:Aasdh UTSW 5 76888654 nonsense probably null
R3836:Aasdh UTSW 5 76878468 missense probably benign 0.32
R4857:Aasdh UTSW 5 76887284 missense probably benign 0.01
R4928:Aasdh UTSW 5 76896688 missense possibly damaging 0.65
R4937:Aasdh UTSW 5 76888654 nonsense probably null
R5762:Aasdh UTSW 5 76896598 missense probably benign 0.00
R5866:Aasdh UTSW 5 76876211 missense probably damaging 1.00
R5940:Aasdh UTSW 5 76882898 missense probably benign 0.07
R6253:Aasdh UTSW 5 76886258 missense possibly damaging 0.81
R6542:Aasdh UTSW 5 76883055 missense probably damaging 1.00
R6825:Aasdh UTSW 5 76888849 splice site probably null
R6868:Aasdh UTSW 5 76891680 missense probably damaging 0.99
R6876:Aasdh UTSW 5 76896441 missense probably damaging 1.00
R6961:Aasdh UTSW 5 76876301 missense probably damaging 1.00
R6963:Aasdh UTSW 5 76896456 missense probably damaging 0.99
R7069:Aasdh UTSW 5 76876356 missense probably benign 0.03
R7220:Aasdh UTSW 5 76901925 missense probably benign 0.13
R7545:Aasdh UTSW 5 76880014 missense probably damaging 1.00
R7673:Aasdh UTSW 5 76882708 missense probably benign 0.03
R7703:Aasdh UTSW 5 76888077 missense probably damaging 0.99
R7890:Aasdh UTSW 5 76884122 missense probably benign 0.19
R7978:Aasdh UTSW 5 76888668 missense probably damaging 0.99
R8046:Aasdh UTSW 5 76896478 missense probably benign
R8152:Aasdh UTSW 5 76896458 missense probably damaging 1.00
R8425:Aasdh UTSW 5 76886277 missense possibly damaging 0.49
R8884:Aasdh UTSW 5 76891794 missense possibly damaging 0.94
Z1088:Aasdh UTSW 5 76901157 splice site probably null
Z1176:Aasdh UTSW 5 76891796 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CTGCTCTCTATGGAAAGGACC -3'
(R):5'- ACCTCCGGTGGAAATTTGAG -3'

Sequencing Primer
(F):5'- GCTCTCTATGGAAAGGACCACAGAC -3'
(R):5'- CTCCGGTGGAAATTTGAGACGAC -3'
Posted On2021-11-19