Mutagenetix > Incidental Mutation

Incidental Mutation 'R9028:Smarca5'

686874

Institutional Source

Beutler Lab

Gene Symbol

Smarca5

Ensembl Gene

ENSMUSG00000031715

Gene Name

SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5

Synonyms

D030040M08Rik, D330027N15Rik, 4933427E24Rik, MommeD4, Snf2h

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9028 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

80698507-80739497 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 80714013 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Methionine at position 607 (I607M)

Ref Sequence

ENSEMBL: ENSMUSP00000044361 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043359]

AlphaFold

Q91ZW3

Predicted Effect

probably damaging
Transcript: ENSMUST00000043359
AA Change: I607M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000044361
Gene: ENSMUSG00000031715
AA Change: I607M

Domain	Start	End	E-Value	Type
low complexity region	2	53	N/A	INTRINSIC
Pfam:DBINO	65	112	1.1e-4	PFAM
low complexity region	145	156	N/A	INTRINSIC
DEXDc	175	367	3.9e-46	SMART
Blast:DEXDc	386	421	6e-11	BLAST
HELICc	512	596	6.2e-28	SMART
low complexity region	756	768	N/A	INTRINSIC
low complexity region	820	837	N/A	INTRINSIC
SANT	840	889	2.3e-7	SMART
SANT	942	1006	3e-7	SMART
low complexity region	1008	1024	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

99% (74/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The protein encoded by this gene is a component of the chromatin remodeling and spacing factor RSF, a facilitator of the transcription of class II genes by RNA polymerase II. The encoded protein is similar in sequence to the Drosophila ISWI chromatin remodeling protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die during early embryonic development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5330417C22Rik	G	A	3: 108,463,503	T687I	probably benign	Het
Aasdh	A	G	5: 76,876,130	V1066A	probably damaging	Het
Abca5	T	A	11: 110,298,078	H851L	probably damaging	Het
Actn2	T	C	13: 12,300,978	I218M	possibly damaging	Het
Afmid	G	A	11: 117,836,663	E338K	probably benign	Het
Amer3	G	A	1: 34,588,677	V666I	probably benign	Het
Apol7b	A	G	15: 77,423,416	V293A	probably damaging	Het
Bag6	T	A	17: 35,144,154	S657T	probably benign	Het
Btaf1	T	C	19: 36,969,108	L438P	probably damaging	Het
Cdc20	T	C	4: 118,436,560	E126G	probably benign	Het
Cep97	C	T	16: 55,919,552	W248*	probably null	Het
Cfap69	A	T	5: 5,646,958	S113T	probably benign	Het
Cgrrf1	C	A	14: 46,853,743	D241E	probably benign	Het
Cnksr1	T	C	4: 134,233,297	T280A	possibly damaging	Het
Cox4i1	T	A	8: 120,671,283		probably benign	Het
Cpm	T	A	10: 117,683,509	F441I	probably benign	Het
Cs	A	C	10: 128,353,083	M154L		Het
Dmrta1	T	A	4: 89,691,677	N291K	probably damaging	Het
Dnah7a	T	C	1: 53,521,138	T2125A	probably benign	Het
Dock10	A	T	1: 80,606,295		probably benign	Het
Dok7	A	G	5: 35,079,475	Y369C	probably damaging	Het
E130311K13Rik	T	C	3: 63,915,548	Y225C	probably damaging	Het
F7	T	C	8: 13,026,087	L10P	possibly damaging	Het
Faf1	C	A	4: 109,890,908	T470K	possibly damaging	Het
Fam83h	A	T	15: 76,003,889	L533Q	possibly damaging	Het
Far1	T	A	7: 113,547,422	V129E	probably damaging	Het
Fgfr4	T	C	13: 55,159,154	Y219H	probably damaging	Het
Fryl	A	T	5: 73,098,266	S807R	probably benign	Het
Gaa	T	A	11: 119,270,381	D83E	probably benign	Het
Gm6970	T	C	19: 47,170,690	K149E	unknown	Het
Grm2	A	G	9: 106,651,185	S167P	possibly damaging	Het
Hibch	T	C	1: 52,853,709	L26P	possibly damaging	Het
Hspa9	T	C	18: 34,942,031	E415G	probably damaging	Het
Ipo4	T	C	14: 55,628,951	Y757C	probably damaging	Het
Itk	T	A	11: 46,344,883		probably benign	Het
Kdm5a	C	T	6: 120,439,131	P1671S	probably benign	Het
Kif13a	G	A	13: 46,798,365	P811S	probably damaging	Het
Kif23	T	C	9: 61,921,059	E857G	probably damaging	Het
Kif2b	A	G	11: 91,577,185	S91P	probably benign	Het
Letm1	G	T	5: 33,752,503	Q396K	probably damaging	Het
Map2k6	T	A	11: 110,497,973	M247K		Het
Mga	A	G	2: 119,947,589	I1872V	probably benign	Het
Mmp15	A	T	8: 95,369,688	N369I	probably benign	Het
Myo3a	T	A	2: 22,600,087	S1487T	possibly damaging	Het
Ncam1	T	C	9: 49,507,436	T855A		Het
Ncoa2	A	G	1: 13,152,855	V1182A	probably benign	Het
Nhlrc3	A	T	3: 53,453,571	C254*	probably null	Het
Nlrp1a	C	T	11: 71,122,993	R477H	probably benign	Het
Nox3	T	A	17: 3,665,910	T407S	possibly damaging	Het
Olfr1229	T	A	2: 89,282,332	D267V	probably damaging	Het
Olfr1375	C	T	11: 51,048,833	T242M	probably damaging	Het
Olfr411	T	C	11: 74,346,921	Y101C	probably damaging	Het
Pfkp	T	A	13: 6,605,689	I303F	probably damaging	Het
Pgc	T	C	17: 47,733,058	Y292H	possibly damaging	Het
Phtf2	A	G	5: 20,794,375	Y257H	probably benign	Het
Pkdrej	T	C	15: 85,816,897	N1613D	probably damaging	Het
Prpmp5	C	T	6: 132,312,655	E69K	unknown	Het
Rapgef2	A	G	3: 79,074,344	S1115P	probably damaging	Het
Rbpj	A	G	5: 53,649,690	E260G	possibly damaging	Het
Rrm1	T	A	7: 102,460,398	N476K	probably damaging	Het
Slc9a2	T	A	1: 40,726,452	I334N	probably damaging	Het
Slk	T	G	19: 47,620,073	N488K	probably benign	Het
Sspo	G	A	6: 48,496,153	V162M	probably benign	Het
Svep1	T	G	4: 58,145,199	Q422P	possibly damaging	Het
Tcn2	C	T	11: 3,922,111	V339I	probably damaging	Het
Tnfrsf19	T	C	14: 61,005,201	H78R	probably benign	Het
Trav14-3	C	A	14: 53,763,430	Q33K	unknown	Het
Ubtd2	T	C	11: 32,499,432	I93T	possibly damaging	Het
Uhrf2	G	A	19: 30,089,344		probably null	Het
Vmn1r224	T	G	17: 20,419,850	S230A	possibly damaging	Het
Wee2	A	T	6: 40,444,255	H93L	probably benign	Het
Zdhhc17	T	C	10: 110,961,073	E279G	probably damaging	Het
Zfp623	T	A	15: 75,947,500	F102I	probably damaging	Het
Zfpm2	A	C	15: 41,103,362	E1081A	possibly damaging	Het
Zscan18	A	T	7: 12,772,189		probably benign	Het

Other mutations in Smarca5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00323:Smarca5	APN	8	80714041	missense	probably benign	0.10
IGL01138:Smarca5	APN	8	80701076	missense	possibly damaging	0.87
IGL01290:Smarca5	APN	8	80727648	missense	probably benign
IGL02338:Smarca5	APN	8	80719570	splice site	probably benign
IGL03212:Smarca5	APN	8	80711781	missense	possibly damaging	0.47
IGL03216:Smarca5	APN	8	80719658	missense	probably damaging	1.00
Cipher	UTSW	8	80719652	missense	probably damaging	1.00
Codebook	UTSW	8	80733707	missense	probably benign
Codex	UTSW	8	80710563	missense	probably damaging	0.99
Encryption	UTSW	8	80704726	missense	probably damaging	1.00
Enigma	UTSW	8	80705332	missense	probably benign	0.35
Key	UTSW	8	80726051	missense	probably damaging	1.00
Sailor	UTSW	8	80736726	missense	probably benign	0.07
Soldier	UTSW	8	80719715	missense	probably damaging	1.00
tinker	UTSW	8	80733750	missense	probably benign
R0254:Smarca5	UTSW	8	80704700	missense	probably benign	0.05
R0374:Smarca5	UTSW	8	80736731	missense	probably benign	0.30
R0625:Smarca5	UTSW	8	80720686	critical splice donor site	probably null
R1065:Smarca5	UTSW	8	80704714	missense	probably damaging	1.00
R1164:Smarca5	UTSW	8	80710631	missense	probably damaging	1.00
R1709:Smarca5	UTSW	8	80709220	nonsense	probably null
R2102:Smarca5	UTSW	8	80704675	missense	probably damaging	1.00
R3831:Smarca5	UTSW	8	80728494	missense	probably damaging	0.99
R4625:Smarca5	UTSW	8	80710563	missense	probably damaging	0.99
R4750:Smarca5	UTSW	8	80733707	missense	probably benign
R4822:Smarca5	UTSW	8	80708680	splice site	probably null
R4889:Smarca5	UTSW	8	80704697	missense	possibly damaging	0.95
R5756:Smarca5	UTSW	8	80710604	missense	probably benign
R6120:Smarca5	UTSW	8	80711743	missense	probably damaging	0.98
R6582:Smarca5	UTSW	8	80719652	missense	probably damaging	1.00
R6939:Smarca5	UTSW	8	80705320	missense	possibly damaging	0.63
R6972:Smarca5	UTSW	8	80704751	missense	probably damaging	1.00
R6973:Smarca5	UTSW	8	80704751	missense	probably damaging	1.00
R7027:Smarca5	UTSW	8	80736726	missense	probably benign	0.07
R7376:Smarca5	UTSW	8	80726051	missense	probably damaging	1.00
R7514:Smarca5	UTSW	8	80717534	missense	probably damaging	1.00
R7962:Smarca5	UTSW	8	80736759	missense	probably benign
R8031:Smarca5	UTSW	8	80704682	missense	probably damaging	1.00
R8400:Smarca5	UTSW	8	80709127	missense	probably benign	0.02
R8798:Smarca5	UTSW	8	80716508	missense	probably damaging	1.00
R8817:Smarca5	UTSW	8	80733750	missense	probably benign
R8824:Smarca5	UTSW	8	80705332	missense	probably benign	0.35
R8905:Smarca5	UTSW	8	80713948	missense	probably benign	0.14
R9018:Smarca5	UTSW	8	80704726	missense	probably damaging	1.00
R9203:Smarca5	UTSW	8	80704629	nonsense	probably null
R9253:Smarca5	UTSW	8	80719715	missense	probably damaging	1.00
R9294:Smarca5	UTSW	8	80719803	missense	probably damaging	1.00
R9328:Smarca5	UTSW	8	80720749	missense	probably benign	0.00
R9396:Smarca5	UTSW	8	80736729	missense	probably benign	0.00
R9514:Smarca5	UTSW	8	80702211	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTTGGCTGTTAGCTGGACTCC -3'
(R):5'- CTCATGCAGTTGGCTTTGTC -3'

Sequencing Primer
(F):5'- GGACTCCAGGTGCTTAAAAATCTC -3'
(R):5'- TGCTTCTCAGTGTACATGT -3'

Posted On

2021-11-19