Incidental Mutation 'R9028:Smarca5'
ID 686874
Institutional Source Beutler Lab
Gene Symbol Smarca5
Ensembl Gene ENSMUSG00000031715
Gene Name SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5
Synonyms D030040M08Rik, D330027N15Rik, 4933427E24Rik, MommeD4, Snf2h
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9028 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 80698507-80739497 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 80714013 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Methionine at position 607 (I607M)
Ref Sequence ENSEMBL: ENSMUSP00000044361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043359]
AlphaFold Q91ZW3
Predicted Effect probably damaging
Transcript: ENSMUST00000043359
AA Change: I607M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000044361
Gene: ENSMUSG00000031715
AA Change: I607M

DomainStartEndE-ValueType
low complexity region 2 53 N/A INTRINSIC
Pfam:DBINO 65 112 1.1e-4 PFAM
low complexity region 145 156 N/A INTRINSIC
DEXDc 175 367 3.9e-46 SMART
Blast:DEXDc 386 421 6e-11 BLAST
HELICc 512 596 6.2e-28 SMART
low complexity region 756 768 N/A INTRINSIC
low complexity region 820 837 N/A INTRINSIC
SANT 840 889 2.3e-7 SMART
SANT 942 1006 3e-7 SMART
low complexity region 1008 1024 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The protein encoded by this gene is a component of the chromatin remodeling and spacing factor RSF, a facilitator of the transcription of class II genes by RNA polymerase II. The encoded protein is similar in sequence to the Drosophila ISWI chromatin remodeling protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die during early embryonic development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik G A 3: 108,463,503 T687I probably benign Het
Aasdh A G 5: 76,876,130 V1066A probably damaging Het
Abca5 T A 11: 110,298,078 H851L probably damaging Het
Actn2 T C 13: 12,300,978 I218M possibly damaging Het
Afmid G A 11: 117,836,663 E338K probably benign Het
Amer3 G A 1: 34,588,677 V666I probably benign Het
Apol7b A G 15: 77,423,416 V293A probably damaging Het
Bag6 T A 17: 35,144,154 S657T probably benign Het
Btaf1 T C 19: 36,969,108 L438P probably damaging Het
Cdc20 T C 4: 118,436,560 E126G probably benign Het
Cep97 C T 16: 55,919,552 W248* probably null Het
Cfap69 A T 5: 5,646,958 S113T probably benign Het
Cgrrf1 C A 14: 46,853,743 D241E probably benign Het
Cnksr1 T C 4: 134,233,297 T280A possibly damaging Het
Cpm T A 10: 117,683,509 F441I probably benign Het
Cs A C 10: 128,353,083 M154L Het
Dmrta1 T A 4: 89,691,677 N291K probably damaging Het
Dnah7a T C 1: 53,521,138 T2125A probably benign Het
Dok7 A G 5: 35,079,475 Y369C probably damaging Het
E130311K13Rik T C 3: 63,915,548 Y225C probably damaging Het
F7 T C 8: 13,026,087 L10P possibly damaging Het
Faf1 C A 4: 109,890,908 T470K possibly damaging Het
Fam83h A T 15: 76,003,889 L533Q possibly damaging Het
Far1 T A 7: 113,547,422 V129E probably damaging Het
Fgfr4 T C 13: 55,159,154 Y219H probably damaging Het
Fryl A T 5: 73,098,266 S807R probably benign Het
Gaa T A 11: 119,270,381 D83E probably benign Het
Gm6970 T C 19: 47,170,690 K149E unknown Het
Grm2 A G 9: 106,651,185 S167P possibly damaging Het
Hibch T C 1: 52,853,709 L26P possibly damaging Het
Hspa9 T C 18: 34,942,031 E415G probably damaging Het
Ipo4 T C 14: 55,628,951 Y757C probably damaging Het
Kdm5a C T 6: 120,439,131 P1671S probably benign Het
Kif13a G A 13: 46,798,365 P811S probably damaging Het
Kif23 T C 9: 61,921,059 E857G probably damaging Het
Kif2b A G 11: 91,577,185 S91P probably benign Het
Letm1 G T 5: 33,752,503 Q396K probably damaging Het
Map2k6 T A 11: 110,497,973 M247K Het
Mga A G 2: 119,947,589 I1872V probably benign Het
Mmp15 A T 8: 95,369,688 N369I probably benign Het
Myo3a T A 2: 22,600,087 S1487T possibly damaging Het
Ncam1 T C 9: 49,507,436 T855A Het
Ncoa2 A G 1: 13,152,855 V1182A probably benign Het
Nhlrc3 A T 3: 53,453,571 C254* probably null Het
Nlrp1a C T 11: 71,122,993 R477H probably benign Het
Nox3 T A 17: 3,665,910 T407S possibly damaging Het
Olfr1229 T A 2: 89,282,332 D267V probably damaging Het
Olfr1375 C T 11: 51,048,833 T242M probably damaging Het
Olfr411 T C 11: 74,346,921 Y101C probably damaging Het
Pfkp T A 13: 6,605,689 I303F probably damaging Het
Pgc T C 17: 47,733,058 Y292H possibly damaging Het
Phtf2 A G 5: 20,794,375 Y257H probably benign Het
Pkdrej T C 15: 85,816,897 N1613D probably damaging Het
Prpmp5 C T 6: 132,312,655 E69K unknown Het
Rapgef2 A G 3: 79,074,344 S1115P probably damaging Het
Rbpj A G 5: 53,649,690 E260G possibly damaging Het
Rrm1 T A 7: 102,460,398 N476K probably damaging Het
Slc9a2 T A 1: 40,726,452 I334N probably damaging Het
Slk T G 19: 47,620,073 N488K probably benign Het
Sspo G A 6: 48,496,153 V162M probably benign Het
Svep1 T G 4: 58,145,199 Q422P possibly damaging Het
Tcn2 C T 11: 3,922,111 V339I probably damaging Het
Tnfrsf19 T C 14: 61,005,201 H78R probably benign Het
Trav14-3 C A 14: 53,763,430 Q33K unknown Het
Ubtd2 T C 11: 32,499,432 I93T possibly damaging Het
Uhrf2 G A 19: 30,089,344 probably null Het
Vmn1r224 T G 17: 20,419,850 S230A possibly damaging Het
Wee2 A T 6: 40,444,255 H93L probably benign Het
Zdhhc17 T C 10: 110,961,073 E279G probably damaging Het
Zfp623 T A 15: 75,947,500 F102I probably damaging Het
Zfpm2 A C 15: 41,103,362 E1081A possibly damaging Het
Other mutations in Smarca5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Smarca5 APN 8 80714041 missense probably benign 0.10
IGL01138:Smarca5 APN 8 80701076 missense possibly damaging 0.87
IGL01290:Smarca5 APN 8 80727648 missense probably benign
IGL02338:Smarca5 APN 8 80719570 splice site probably benign
IGL03212:Smarca5 APN 8 80711781 missense possibly damaging 0.47
IGL03216:Smarca5 APN 8 80719658 missense probably damaging 1.00
Cipher UTSW 8 80719652 missense probably damaging 1.00
Codebook UTSW 8 80733707 missense probably benign
Codex UTSW 8 80710563 missense probably damaging 0.99
Enigma UTSW 8 80705332 missense probably benign 0.35
Key UTSW 8 80726051 missense probably damaging 1.00
tinker UTSW 8 80733750 missense probably benign
R0254:Smarca5 UTSW 8 80704700 missense probably benign 0.05
R0374:Smarca5 UTSW 8 80736731 missense probably benign 0.30
R0625:Smarca5 UTSW 8 80720686 critical splice donor site probably null
R1065:Smarca5 UTSW 8 80704714 missense probably damaging 1.00
R1164:Smarca5 UTSW 8 80710631 missense probably damaging 1.00
R1709:Smarca5 UTSW 8 80709220 nonsense probably null
R2102:Smarca5 UTSW 8 80704675 missense probably damaging 1.00
R3831:Smarca5 UTSW 8 80728494 missense probably damaging 0.99
R4625:Smarca5 UTSW 8 80710563 missense probably damaging 0.99
R4750:Smarca5 UTSW 8 80733707 missense probably benign
R4822:Smarca5 UTSW 8 80708680 splice site probably null
R4889:Smarca5 UTSW 8 80704697 missense possibly damaging 0.95
R5756:Smarca5 UTSW 8 80710604 missense probably benign
R6120:Smarca5 UTSW 8 80711743 missense probably damaging 0.98
R6582:Smarca5 UTSW 8 80719652 missense probably damaging 1.00
R6939:Smarca5 UTSW 8 80705320 missense possibly damaging 0.63
R6972:Smarca5 UTSW 8 80704751 missense probably damaging 1.00
R6973:Smarca5 UTSW 8 80704751 missense probably damaging 1.00
R7027:Smarca5 UTSW 8 80736726 missense probably benign 0.07
R7376:Smarca5 UTSW 8 80726051 missense probably damaging 1.00
R7514:Smarca5 UTSW 8 80717534 missense probably damaging 1.00
R7962:Smarca5 UTSW 8 80736759 missense probably benign
R8031:Smarca5 UTSW 8 80704682 missense probably damaging 1.00
R8400:Smarca5 UTSW 8 80709127 missense probably benign 0.02
R8798:Smarca5 UTSW 8 80716508 missense probably damaging 1.00
R8817:Smarca5 UTSW 8 80733750 missense probably benign
R8824:Smarca5 UTSW 8 80705332 missense probably benign 0.35
R8905:Smarca5 UTSW 8 80713948 missense probably benign 0.14
R9018:Smarca5 UTSW 8 80704726 missense probably damaging 1.00
R9203:Smarca5 UTSW 8 80704629 nonsense probably null
R9253:Smarca5 UTSW 8 80719715 missense probably damaging 1.00
R9294:Smarca5 UTSW 8 80719803 missense probably damaging 1.00
R9328:Smarca5 UTSW 8 80720749 missense probably benign 0.00
R9396:Smarca5 UTSW 8 80736729 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTTGGCTGTTAGCTGGACTCC -3'
(R):5'- CTCATGCAGTTGGCTTTGTC -3'

Sequencing Primer
(F):5'- GGACTCCAGGTGCTTAAAAATCTC -3'
(R):5'- TGCTTCTCAGTGTACATGT -3'
Posted On 2021-11-19