Mutagenetix > Incidental Mutation

Incidental Mutation 'R9028:Grm2'

686878

Institutional Source

Beutler Lab

Gene Symbol

Grm2

Ensembl Gene

ENSMUSG00000023192

Gene Name

glutamate receptor, metabotropic 2

Synonyms

4930441L02Rik, mGluR2, Gprc1b

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.533) question?

Stock #

R9028 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

106643095-106656082 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 106651185 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 167 (S167P)

Ref Sequence

ENSEMBL: ENSMUSP00000144631 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023959] [ENSMUST00000201681]

AlphaFold

Q14BI2

Predicted Effect

probably damaging
Transcript: ENSMUST00000023959
AA Change: S167P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000023959
Gene: ENSMUSG00000023192
AA Change: S167P

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	60	460	1.3e-96	PFAM
Pfam:NCD3G	496	546	3.7e-13	PFAM
Pfam:7tm_3	579	816	4.3e-63	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000200826

Predicted Effect

possibly damaging
Transcript: ENSMUST00000201681
AA Change: S167P

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000144631
Gene: ENSMUSG00000023192
AA Change: S167P

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	60	460	4.1e-95	PFAM
Pfam:7tm_3	458	538	4.6e-18	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

99% (74/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors, that have been divided into 3 groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5 and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3 while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2017]
PHENOTYPE: Mice homozygous for disruptions in this gene display subtile behavioral modifications and moderate abnormalities in long term depression and EPSP in the hippocampus. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5330417C22Rik	G	A	3: 108,463,503	T687I	probably benign	Het
Aasdh	A	G	5: 76,876,130	V1066A	probably damaging	Het
Abca5	T	A	11: 110,298,078	H851L	probably damaging	Het
Actn2	T	C	13: 12,300,978	I218M	possibly damaging	Het
Afmid	G	A	11: 117,836,663	E338K	probably benign	Het
Amer3	G	A	1: 34,588,677	V666I	probably benign	Het
Apol7b	A	G	15: 77,423,416	V293A	probably damaging	Het
Bag6	T	A	17: 35,144,154	S657T	probably benign	Het
Btaf1	T	C	19: 36,969,108	L438P	probably damaging	Het
Cdc20	T	C	4: 118,436,560	E126G	probably benign	Het
Cep97	C	T	16: 55,919,552	W248*	probably null	Het
Cfap69	A	T	5: 5,646,958	S113T	probably benign	Het
Cgrrf1	C	A	14: 46,853,743	D241E	probably benign	Het
Cnksr1	T	C	4: 134,233,297	T280A	possibly damaging	Het
Cox4i1	T	A	8: 120,671,283		probably benign	Het
Cpm	T	A	10: 117,683,509	F441I	probably benign	Het
Cs	A	C	10: 128,353,083	M154L		Het
Dmrta1	T	A	4: 89,691,677	N291K	probably damaging	Het
Dnah7a	T	C	1: 53,521,138	T2125A	probably benign	Het
Dock10	A	T	1: 80,606,295		probably benign	Het
Dok7	A	G	5: 35,079,475	Y369C	probably damaging	Het
E130311K13Rik	T	C	3: 63,915,548	Y225C	probably damaging	Het
F7	T	C	8: 13,026,087	L10P	possibly damaging	Het
Faf1	C	A	4: 109,890,908	T470K	possibly damaging	Het
Fam83h	A	T	15: 76,003,889	L533Q	possibly damaging	Het
Far1	T	A	7: 113,547,422	V129E	probably damaging	Het
Fgfr4	T	C	13: 55,159,154	Y219H	probably damaging	Het
Fryl	A	T	5: 73,098,266	S807R	probably benign	Het
Gaa	T	A	11: 119,270,381	D83E	probably benign	Het
Gm6970	T	C	19: 47,170,690	K149E	unknown	Het
Hibch	T	C	1: 52,853,709	L26P	possibly damaging	Het
Hspa9	T	C	18: 34,942,031	E415G	probably damaging	Het
Ipo4	T	C	14: 55,628,951	Y757C	probably damaging	Het
Itk	T	A	11: 46,344,883		probably benign	Het
Kdm5a	C	T	6: 120,439,131	P1671S	probably benign	Het
Kif13a	G	A	13: 46,798,365	P811S	probably damaging	Het
Kif23	T	C	9: 61,921,059	E857G	probably damaging	Het
Kif2b	A	G	11: 91,577,185	S91P	probably benign	Het
Letm1	G	T	5: 33,752,503	Q396K	probably damaging	Het
Map2k6	T	A	11: 110,497,973	M247K		Het
Mga	A	G	2: 119,947,589	I1872V	probably benign	Het
Mmp15	A	T	8: 95,369,688	N369I	probably benign	Het
Myo3a	T	A	2: 22,600,087	S1487T	possibly damaging	Het
Ncam1	T	C	9: 49,507,436	T855A		Het
Ncoa2	A	G	1: 13,152,855	V1182A	probably benign	Het
Nhlrc3	A	T	3: 53,453,571	C254*	probably null	Het
Nlrp1a	C	T	11: 71,122,993	R477H	probably benign	Het
Nox3	T	A	17: 3,665,910	T407S	possibly damaging	Het
Olfr1229	T	A	2: 89,282,332	D267V	probably damaging	Het
Olfr1375	C	T	11: 51,048,833	T242M	probably damaging	Het
Olfr411	T	C	11: 74,346,921	Y101C	probably damaging	Het
Pfkp	T	A	13: 6,605,689	I303F	probably damaging	Het
Pgc	T	C	17: 47,733,058	Y292H	possibly damaging	Het
Phtf2	A	G	5: 20,794,375	Y257H	probably benign	Het
Pkdrej	T	C	15: 85,816,897	N1613D	probably damaging	Het
Prpmp5	C	T	6: 132,312,655	E69K	unknown	Het
Rapgef2	A	G	3: 79,074,344	S1115P	probably damaging	Het
Rbpj	A	G	5: 53,649,690	E260G	possibly damaging	Het
Rrm1	T	A	7: 102,460,398	N476K	probably damaging	Het
Slc9a2	T	A	1: 40,726,452	I334N	probably damaging	Het
Slk	T	G	19: 47,620,073	N488K	probably benign	Het
Smarca5	T	C	8: 80,714,013	I607M	probably damaging	Het
Sspo	G	A	6: 48,496,153	V162M	probably benign	Het
Svep1	T	G	4: 58,145,199	Q422P	possibly damaging	Het
Tcn2	C	T	11: 3,922,111	V339I	probably damaging	Het
Tnfrsf19	T	C	14: 61,005,201	H78R	probably benign	Het
Trav14-3	C	A	14: 53,763,430	Q33K	unknown	Het
Ubtd2	T	C	11: 32,499,432	I93T	possibly damaging	Het
Uhrf2	G	A	19: 30,089,344		probably null	Het
Vmn1r224	T	G	17: 20,419,850	S230A	possibly damaging	Het
Wee2	A	T	6: 40,444,255	H93L	probably benign	Het
Zdhhc17	T	C	10: 110,961,073	E279G	probably damaging	Het
Zfp623	T	A	15: 75,947,500	F102I	probably damaging	Het
Zfpm2	A	C	15: 41,103,362	E1081A	possibly damaging	Het
Zscan18	A	T	7: 12,772,189		probably benign	Het

Other mutations in Grm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R1053:Grm2	UTSW	9	106648157	missense	probably damaging	0.98
R1116:Grm2	UTSW	9	106647927	missense	probably damaging	0.97
R1593:Grm2	UTSW	9	106650914	missense	probably damaging	1.00
R1619:Grm2	UTSW	9	106647471	missense	probably damaging	1.00
R2174:Grm2	UTSW	9	106647795	missense	probably benign	0.05
R2357:Grm2	UTSW	9	106647581	missense	probably damaging	0.99
R3115:Grm2	UTSW	9	106647623	missense	probably damaging	0.97
R4453:Grm2	UTSW	9	106653879	missense	probably damaging	0.97
R4700:Grm2	UTSW	9	106653931	missense	probably benign	0.18
R4854:Grm2	UTSW	9	106654132	missense	possibly damaging	0.80
R4871:Grm2	UTSW	9	106647645	missense	probably benign	0.00
R4888:Grm2	UTSW	9	106650666	missense	probably damaging	0.98
R4999:Grm2	UTSW	9	106653990	missense	probably damaging	1.00
R5617:Grm2	UTSW	9	106651076	splice site	probably null
R5620:Grm2	UTSW	9	106650446	missense	probably damaging	0.96
R6021:Grm2	UTSW	9	106650800	missense	probably damaging	1.00
R6089:Grm2	UTSW	9	106653891	missense	probably damaging	1.00
R6662:Grm2	UTSW	9	106648053	missense	probably benign	0.01
R7061:Grm2	UTSW	9	106651225	missense	probably damaging	0.98
R7266:Grm2	UTSW	9	106647171	missense
R7270:Grm2	UTSW	9	106651058	missense	probably damaging	0.98
R7479:Grm2	UTSW	9	106653851	missense	possibly damaging	0.84
R7542:Grm2	UTSW	9	106651169	missense	probably damaging	0.98
R8960:Grm2	UTSW	9	106654146	missense	probably benign	0.06
R9150:Grm2	UTSW	9	106647458	missense
R9333:Grm2	UTSW	9	106648217	missense	possibly damaging	0.71
R9345:Grm2	UTSW	9	106651088	missense	probably damaging	0.98
R9520:Grm2	UTSW	9	106648031	missense
R9594:Grm2	UTSW	9	106647209	missense	probably damaging	1.00
Z1177:Grm2	UTSW	9	106645065	missense	possibly damaging	0.86

Predicted Primers

PCR Primer
(F):5'- AAGTGGCCACGCAGATGTTG -3'
(R):5'- CTCAGCTAGAAGACACATCAAGTTCAG -3'

Sequencing Primer
(F):5'- TCGAGCTCGAAGGCCTCAATG -3'
(R):5'- ACTCAGGTCTTTACAGGTAGGGAC -3'

Posted On

2021-11-19