Incidental Mutation 'R9028:Tcn2'
ID 686882
Institutional Source Beutler Lab
Gene Symbol Tcn2
Ensembl Gene ENSMUSG00000020432
Gene Name transcobalamin 2
Synonyms Tcn-2
MMRRC Submission 068857-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.063) question?
Stock # R9028 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 3867192-3882159 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 3872111 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 339 (V339I)
Ref Sequence ENSEMBL: ENSMUSP00000105617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020710] [ENSMUST00000109988] [ENSMUST00000109989] [ENSMUST00000109990] [ENSMUST00000109991] [ENSMUST00000109992] [ENSMUST00000109993]
AlphaFold O88968
Predicted Effect probably damaging
Transcript: ENSMUST00000020710
AA Change: V339I

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000020710
Gene: ENSMUSG00000020432
AA Change: V339I

DomainStartEndE-ValueType
Pfam:Cobalamin_bind 1 333 3.1e-138 PFAM
Pfam:SLBB 332 387 4.3e-7 PFAM
Pfam:DUF4430 355 426 7.9e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109988
AA Change: V339I

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105615
Gene: ENSMUSG00000020432
AA Change: V339I

DomainStartEndE-ValueType
Pfam:Cobalamin_bind 1 333 3.1e-138 PFAM
Pfam:SLBB 332 387 4.3e-7 PFAM
Pfam:DUF4430 355 426 7.9e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109989
AA Change: V339I

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105616
Gene: ENSMUSG00000020432
AA Change: V339I

DomainStartEndE-ValueType
Pfam:Cobalamin_bind 1 333 3.1e-138 PFAM
Pfam:SLBB 332 387 4.3e-7 PFAM
Pfam:DUF4430 355 426 7.9e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109990
AA Change: V339I

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105617
Gene: ENSMUSG00000020432
AA Change: V339I

DomainStartEndE-ValueType
Pfam:Cobalamin_bind 1 333 3.1e-138 PFAM
Pfam:SLBB 332 387 4.3e-7 PFAM
Pfam:DUF4430 355 426 7.9e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109991
AA Change: V339I

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105618
Gene: ENSMUSG00000020432
AA Change: V339I

DomainStartEndE-ValueType
Pfam:Cobalamin_bind 3 331 1.2e-118 PFAM
Pfam:SLBB 332 387 4.3e-7 PFAM
Pfam:DUF4430 355 429 9.3e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109992
AA Change: V339I

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105619
Gene: ENSMUSG00000020432
AA Change: V339I

DomainStartEndE-ValueType
Pfam:Cobalamin_bind 1 333 3.1e-138 PFAM
Pfam:SLBB 332 387 4.3e-7 PFAM
Pfam:DUF4430 355 426 7.9e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109993
AA Change: V339I

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105620
Gene: ENSMUSG00000020432
AA Change: V339I

DomainStartEndE-ValueType
Pfam:Cobalamin_bind 1 333 3.1e-138 PFAM
Pfam:SLBB 332 387 4.3e-7 PFAM
Pfam:DUF4430 355 426 7.9e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vitamin B12-binding protein family. This family of proteins, alternatively referred to as R binders, is expressed in various tissues and secretions. This plasma protein binds cobalamin and mediates the transport of cobalamin into cells. This protein and other mammalian cobalamin-binding proteins, such as transcobalamin I and gastric intrisic factor, may have evolved by duplication of a common ancestral gene. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
PHENOTYPE: This locus controls transcobalamin-2 electrophoretic variation. The s allele determines a slow band in serum from A/J, C57BL/6, BALB/c and C3H/He; the f allele determines faster form in NZB, ST/b and CPB-WV. Heterozygotes have both forms. Sequencing reveals a Gly to Glu substitution in NZB compared to BALB/c, DBA/2 and C57BL/6 (Genbank AF090686). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 77,023,977 (GRCm39) V1066A probably damaging Het
Abca5 T A 11: 110,188,904 (GRCm39) H851L probably damaging Het
Actn2 T C 13: 12,315,864 (GRCm39) I218M possibly damaging Het
Afmid G A 11: 117,727,489 (GRCm39) E338K probably benign Het
Amer3 G A 1: 34,627,758 (GRCm39) V666I probably benign Het
Apol7b A G 15: 77,307,616 (GRCm39) V293A probably damaging Het
Bag6 T A 17: 35,363,130 (GRCm39) S657T probably benign Het
Btaf1 T C 19: 36,946,508 (GRCm39) L438P probably damaging Het
Cdc20 T C 4: 118,293,757 (GRCm39) E126G probably benign Het
Cep97 C T 16: 55,739,915 (GRCm39) W248* probably null Het
Cfap69 A T 5: 5,696,958 (GRCm39) S113T probably benign Het
Cgrrf1 C A 14: 47,091,200 (GRCm39) D241E probably benign Het
Cnksr1 T C 4: 133,960,608 (GRCm39) T280A possibly damaging Het
Cox4i1 T A 8: 121,398,022 (GRCm39) probably benign Het
Cpm T A 10: 117,519,414 (GRCm39) F441I probably benign Het
Cs A C 10: 128,188,952 (GRCm39) M154L Het
Dmrta1 T A 4: 89,579,914 (GRCm39) N291K probably damaging Het
Dnah7a T C 1: 53,560,297 (GRCm39) T2125A probably benign Het
Dock10 A T 1: 80,584,012 (GRCm39) probably benign Het
Dok7 A G 5: 35,236,819 (GRCm39) Y369C probably damaging Het
E130311K13Rik T C 3: 63,822,969 (GRCm39) Y225C probably damaging Het
Elapor1 G A 3: 108,370,819 (GRCm39) T687I probably benign Het
F7 T C 8: 13,076,087 (GRCm39) L10P possibly damaging Het
Faf1 C A 4: 109,748,105 (GRCm39) T470K possibly damaging Het
Fam83h A T 15: 75,875,738 (GRCm39) L533Q possibly damaging Het
Far1 T A 7: 113,146,629 (GRCm39) V129E probably damaging Het
Fgfr4 T C 13: 55,306,967 (GRCm39) Y219H probably damaging Het
Fryl A T 5: 73,255,609 (GRCm39) S807R probably benign Het
Gaa T A 11: 119,161,207 (GRCm39) D83E probably benign Het
Grm2 A G 9: 106,528,384 (GRCm39) S167P possibly damaging Het
H1f11-ps T C 19: 47,159,129 (GRCm39) K149E unknown Het
Hibch T C 1: 52,892,868 (GRCm39) L26P possibly damaging Het
Hspa9 T C 18: 35,075,084 (GRCm39) E415G probably damaging Het
Ipo4 T C 14: 55,866,408 (GRCm39) Y757C probably damaging Het
Itk T A 11: 46,235,710 (GRCm39) probably benign Het
Kdm5a C T 6: 120,416,092 (GRCm39) P1671S probably benign Het
Kif13a G A 13: 46,951,841 (GRCm39) P811S probably damaging Het
Kif23 T C 9: 61,828,341 (GRCm39) E857G probably damaging Het
Kif2b A G 11: 91,468,011 (GRCm39) S91P probably benign Het
Letm1 G T 5: 33,909,847 (GRCm39) Q396K probably damaging Het
Map2k6 T A 11: 110,388,799 (GRCm39) M247K Het
Mga A G 2: 119,778,070 (GRCm39) I1872V probably benign Het
Mmp15 A T 8: 96,096,316 (GRCm39) N369I probably benign Het
Myo3a T A 2: 22,490,099 (GRCm39) S1487T possibly damaging Het
Ncam1 T C 9: 49,418,736 (GRCm39) T855A Het
Ncoa2 A G 1: 13,223,079 (GRCm39) V1182A probably benign Het
Nhlrc3 A T 3: 53,360,992 (GRCm39) C254* probably null Het
Nlrp1a C T 11: 71,013,819 (GRCm39) R477H probably benign Het
Nox3 T A 17: 3,716,185 (GRCm39) T407S possibly damaging Het
Or1x6 C T 11: 50,939,660 (GRCm39) T242M probably damaging Het
Or3a1d T C 11: 74,237,747 (GRCm39) Y101C probably damaging Het
Or4c15b T A 2: 89,112,676 (GRCm39) D267V probably damaging Het
Pfkp T A 13: 6,655,725 (GRCm39) I303F probably damaging Het
Pgc T C 17: 48,043,983 (GRCm39) Y292H possibly damaging Het
Phtf2 A G 5: 20,999,373 (GRCm39) Y257H probably benign Het
Pkdrej T C 15: 85,701,098 (GRCm39) N1613D probably damaging Het
Prb1b C T 6: 132,289,618 (GRCm39) E69K unknown Het
Rapgef2 A G 3: 78,981,651 (GRCm39) S1115P probably damaging Het
Rbpj A G 5: 53,807,032 (GRCm39) E260G possibly damaging Het
Rrm1 T A 7: 102,109,605 (GRCm39) N476K probably damaging Het
Slc9a2 T A 1: 40,765,612 (GRCm39) I334N probably damaging Het
Slk T G 19: 47,608,512 (GRCm39) N488K probably benign Het
Smarca5 T C 8: 81,440,642 (GRCm39) I607M probably damaging Het
Sspo G A 6: 48,473,087 (GRCm39) V162M probably benign Het
Svep1 T G 4: 58,145,199 (GRCm39) Q422P possibly damaging Het
Tnfrsf19 T C 14: 61,242,650 (GRCm39) H78R probably benign Het
Trav14-3 C A 14: 54,000,887 (GRCm39) Q33K unknown Het
Ubtd2 T C 11: 32,449,432 (GRCm39) I93T possibly damaging Het
Uhrf2 G A 19: 30,066,744 (GRCm39) probably null Het
Vmn1r224 T G 17: 20,640,112 (GRCm39) S230A possibly damaging Het
Wee2 A T 6: 40,421,189 (GRCm39) H93L probably benign Het
Zdhhc17 T C 10: 110,796,934 (GRCm39) E279G probably damaging Het
Zfp623 T A 15: 75,819,349 (GRCm39) F102I probably damaging Het
Zfpm2 A C 15: 40,966,758 (GRCm39) E1081A possibly damaging Het
Zscan18 A T 7: 12,506,116 (GRCm39) probably benign Het
Other mutations in Tcn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01962:Tcn2 APN 11 3,875,072 (GRCm39) missense probably benign
IGL02311:Tcn2 APN 11 3,867,692 (GRCm39) missense probably damaging 1.00
IGL02614:Tcn2 APN 11 3,876,158 (GRCm39) missense possibly damaging 0.91
IGL02655:Tcn2 APN 11 3,876,158 (GRCm39) missense possibly damaging 0.91
IGL02679:Tcn2 APN 11 3,877,504 (GRCm39) missense possibly damaging 0.93
IGL02752:Tcn2 APN 11 3,876,158 (GRCm39) missense possibly damaging 0.91
R0265:Tcn2 UTSW 11 3,872,044 (GRCm39) missense probably damaging 1.00
R0845:Tcn2 UTSW 11 3,869,349 (GRCm39) missense probably benign
R1255:Tcn2 UTSW 11 3,872,120 (GRCm39) missense probably benign 0.16
R1459:Tcn2 UTSW 11 3,877,516 (GRCm39) missense probably benign 0.01
R1696:Tcn2 UTSW 11 3,872,169 (GRCm39) missense probably damaging 1.00
R4209:Tcn2 UTSW 11 3,872,114 (GRCm39) missense possibly damaging 0.91
R4210:Tcn2 UTSW 11 3,872,114 (GRCm39) missense possibly damaging 0.91
R4211:Tcn2 UTSW 11 3,872,114 (GRCm39) missense possibly damaging 0.91
R5357:Tcn2 UTSW 11 3,876,017 (GRCm39) missense possibly damaging 0.91
R5973:Tcn2 UTSW 11 3,877,546 (GRCm39) nonsense probably null
R6973:Tcn2 UTSW 11 3,867,649 (GRCm39) makesense probably null
R7479:Tcn2 UTSW 11 3,867,703 (GRCm39) missense probably damaging 1.00
R8023:Tcn2 UTSW 11 3,877,579 (GRCm39) missense possibly damaging 0.95
R8854:Tcn2 UTSW 11 3,876,074 (GRCm39) missense possibly damaging 0.90
R8919:Tcn2 UTSW 11 3,873,569 (GRCm39) missense probably damaging 1.00
R9352:Tcn2 UTSW 11 3,873,446 (GRCm39) missense probably damaging 1.00
T0975:Tcn2 UTSW 11 3,873,487 (GRCm39) missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- CATGATACCATTTCAAGCACGG -3'
(R):5'- AGATGAGACCCGGGTTTCAG -3'

Sequencing Primer
(F):5'- ATTTCAAGCACGGAGGCCTG -3'
(R):5'- CTGAGCTATTTCGAGGGAAGGCC -3'
Posted On 2021-11-19