Incidental Mutation 'R9028:Nlrp1a'
ID 686885
Institutional Source Beutler Lab
Gene Symbol Nlrp1a
Ensembl Gene ENSMUSG00000069830
Gene Name NLR family, pyrin domain containing 1A
Synonyms Nalp1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock # R9028 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 71092236-71144704 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 71122993 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 477 (R477H)
Ref Sequence ENSEMBL: ENSMUSP00000038186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048514] [ENSMUST00000108518]
AlphaFold Q2LKU9
Predicted Effect probably benign
Transcript: ENSMUST00000048514
AA Change: R477H

PolyPhen 2 Score 0.272 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000038186
Gene: ENSMUSG00000069830
AA Change: R477H

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
Pfam:NACHT 133 302 4.6e-41 PFAM
low complexity region 482 494 N/A INTRINSIC
LRR 632 659 4.53e-1 SMART
LRR 742 769 3.04e-5 SMART
low complexity region 856 870 N/A INTRINSIC
Pfam:FIIND 921 1173 1.6e-102 PFAM
Pfam:CARD 1209 1292 2.3e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108518
AA Change: R477H

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000104158
Gene: ENSMUSG00000069830
AA Change: R477H

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
Pfam:NACHT 133 302 1.1e-40 PFAM
low complexity region 482 494 N/A INTRINSIC
LRR 632 659 4.53e-1 SMART
LRR 661 688 2.85e1 SMART
LRR 689 716 3.04e-5 SMART
Pfam:FIIND 819 1073 3e-136 PFAM
Pfam:CARD 1091 1174 8.2e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice heterozygous for an ENU-induced allele develop a multi-organ neutrophilic inflammatory disease. Homozygotes for the same ENU-induced allele develop a similar but lethal condition and exhibit neutrophilia, lymphopenia, splenomegaly, loss of peritoneal macrophages, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik G A 3: 108,463,503 T687I probably benign Het
Aasdh A G 5: 76,876,130 V1066A probably damaging Het
Abca5 T A 11: 110,298,078 H851L probably damaging Het
Actn2 T C 13: 12,300,978 I218M possibly damaging Het
Afmid G A 11: 117,836,663 E338K probably benign Het
Amer3 G A 1: 34,588,677 V666I probably benign Het
Apol7b A G 15: 77,423,416 V293A probably damaging Het
Bag6 T A 17: 35,144,154 S657T probably benign Het
Btaf1 T C 19: 36,969,108 L438P probably damaging Het
Cdc20 T C 4: 118,436,560 E126G probably benign Het
Cep97 C T 16: 55,919,552 W248* probably null Het
Cfap69 A T 5: 5,646,958 S113T probably benign Het
Cgrrf1 C A 14: 46,853,743 D241E probably benign Het
Cnksr1 T C 4: 134,233,297 T280A possibly damaging Het
Cpm T A 10: 117,683,509 F441I probably benign Het
Cs A C 10: 128,353,083 M154L Het
Dmrta1 T A 4: 89,691,677 N291K probably damaging Het
Dnah7a T C 1: 53,521,138 T2125A probably benign Het
Dok7 A G 5: 35,079,475 Y369C probably damaging Het
E130311K13Rik T C 3: 63,915,548 Y225C probably damaging Het
F7 T C 8: 13,026,087 L10P possibly damaging Het
Faf1 C A 4: 109,890,908 T470K possibly damaging Het
Fam83h A T 15: 76,003,889 L533Q possibly damaging Het
Far1 T A 7: 113,547,422 V129E probably damaging Het
Fgfr4 T C 13: 55,159,154 Y219H probably damaging Het
Fryl A T 5: 73,098,266 S807R probably benign Het
Gaa T A 11: 119,270,381 D83E probably benign Het
Gm6970 T C 19: 47,170,690 K149E unknown Het
Grm2 A G 9: 106,651,185 S167P possibly damaging Het
Hibch T C 1: 52,853,709 L26P possibly damaging Het
Hspa9 T C 18: 34,942,031 E415G probably damaging Het
Ipo4 T C 14: 55,628,951 Y757C probably damaging Het
Kdm5a C T 6: 120,439,131 P1671S probably benign Het
Kif13a G A 13: 46,798,365 P811S probably damaging Het
Kif23 T C 9: 61,921,059 E857G probably damaging Het
Kif2b A G 11: 91,577,185 S91P probably benign Het
Letm1 G T 5: 33,752,503 Q396K probably damaging Het
Map2k6 T A 11: 110,497,973 M247K Het
Mga A G 2: 119,947,589 I1872V probably benign Het
Mmp15 A T 8: 95,369,688 N369I probably benign Het
Myo3a T A 2: 22,600,087 S1487T possibly damaging Het
Ncam1 T C 9: 49,507,436 T855A Het
Ncoa2 A G 1: 13,152,855 V1182A probably benign Het
Nhlrc3 A T 3: 53,453,571 C254* probably null Het
Nox3 T A 17: 3,665,910 T407S possibly damaging Het
Olfr1229 T A 2: 89,282,332 D267V probably damaging Het
Olfr1375 C T 11: 51,048,833 T242M probably damaging Het
Olfr411 T C 11: 74,346,921 Y101C probably damaging Het
Pfkp T A 13: 6,605,689 I303F probably damaging Het
Pgc T C 17: 47,733,058 Y292H possibly damaging Het
Phtf2 A G 5: 20,794,375 Y257H probably benign Het
Pkdrej T C 15: 85,816,897 N1613D probably damaging Het
Prpmp5 C T 6: 132,312,655 E69K unknown Het
Rapgef2 A G 3: 79,074,344 S1115P probably damaging Het
Rbpj A G 5: 53,649,690 E260G possibly damaging Het
Rrm1 T A 7: 102,460,398 N476K probably damaging Het
Slc9a2 T A 1: 40,726,452 I334N probably damaging Het
Slk T G 19: 47,620,073 N488K probably benign Het
Smarca5 T C 8: 80,714,013 I607M probably damaging Het
Sspo G A 6: 48,496,153 V162M probably benign Het
Svep1 T G 4: 58,145,199 Q422P possibly damaging Het
Tcn2 C T 11: 3,922,111 V339I probably damaging Het
Tnfrsf19 T C 14: 61,005,201 H78R probably benign Het
Trav14-3 C A 14: 53,763,430 Q33K unknown Het
Ubtd2 T C 11: 32,499,432 I93T possibly damaging Het
Uhrf2 G A 19: 30,089,344 probably null Het
Vmn1r224 T G 17: 20,419,850 S230A possibly damaging Het
Wee2 A T 6: 40,444,255 H93L probably benign Het
Zdhhc17 T C 10: 110,961,073 E279G probably damaging Het
Zfp623 T A 15: 75,947,500 F102I probably damaging Het
Zfpm2 A C 15: 41,103,362 E1081A possibly damaging Het
Other mutations in Nlrp1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00648:Nlrp1a APN 11 71092957 missense probably benign 0.00
IGL00771:Nlrp1a APN 11 71122741 nonsense probably null
IGL01408:Nlrp1a APN 11 71122916 missense probably benign 0.04
IGL01886:Nlrp1a APN 11 71123501 missense probably benign
IGL02221:Nlrp1a APN 11 71123118 missense possibly damaging 0.88
IGL02291:Nlrp1a APN 11 71122589 critical splice donor site probably null
IGL02375:Nlrp1a APN 11 71113513 nonsense probably null
IGL02408:Nlrp1a APN 11 71122630 missense probably benign 0.00
IGL02516:Nlrp1a APN 11 71114460 missense probably damaging 1.00
IGL02583:Nlrp1a APN 11 71123401 missense probably benign 0.03
IGL02622:Nlrp1a APN 11 71123000 missense possibly damaging 0.88
IGL02642:Nlrp1a APN 11 71123532 missense probably benign 0.12
IGL02823:Nlrp1a APN 11 71092423 missense probably damaging 0.96
IGL02859:Nlrp1a APN 11 71106086 missense possibly damaging 0.57
IGL02997:Nlrp1a APN 11 71123665 missense probably damaging 1.00
IGL03342:Nlrp1a APN 11 71122791 missense probably benign 0.19
Ants UTSW 11 71142338 missense probably benign 0.01
dreary UTSW 11 71113640 critical splice acceptor site probably null
picnic UTSW 11 71122747 missense possibly damaging 0.87
seedless UTSW 11 71123552 missense probably benign 0.44
watermelon UTSW 11 71122705 missense probably benign 0.08
R0022:Nlrp1a UTSW 11 71123381 missense probably damaging 0.99
R0345:Nlrp1a UTSW 11 71123675 missense probably damaging 1.00
R0360:Nlrp1a UTSW 11 71114004 intron probably benign
R0364:Nlrp1a UTSW 11 71114004 intron probably benign
R0566:Nlrp1a UTSW 11 71122942 missense probably benign 0.00
R1177:Nlrp1a UTSW 11 71107721 missense probably damaging 1.00
R1240:Nlrp1a UTSW 11 71113466 critical splice donor site probably null
R1263:Nlrp1a UTSW 11 71097122 missense probably benign 0.01
R1681:Nlrp1a UTSW 11 71142358 missense unknown
R1743:Nlrp1a UTSW 11 71124206 missense probably benign 0.04
R1826:Nlrp1a UTSW 11 71107980 intron probably benign
R1826:Nlrp1a UTSW 11 71122747 missense possibly damaging 0.87
R1981:Nlrp1a UTSW 11 71098938 missense probably damaging 1.00
R2083:Nlrp1a UTSW 11 71124220 missense possibly damaging 0.59
R2116:Nlrp1a UTSW 11 71114500 nonsense probably null
R2134:Nlrp1a UTSW 11 71124188 missense probably benign 0.00
R2148:Nlrp1a UTSW 11 71122907 nonsense probably null
R2301:Nlrp1a UTSW 11 71106101 missense possibly damaging 0.94
R3029:Nlrp1a UTSW 11 71123630 missense probably damaging 1.00
R3113:Nlrp1a UTSW 11 71123665 missense probably damaging 1.00
R3801:Nlrp1a UTSW 11 71122703 missense probably benign 0.08
R3898:Nlrp1a UTSW 11 71122874 missense probably benign 0.00
R4254:Nlrp1a UTSW 11 71123028 nonsense probably null
R4397:Nlrp1a UTSW 11 71097204 missense probably benign 0.00
R4647:Nlrp1a UTSW 11 71097126 splice site probably null
R4740:Nlrp1a UTSW 11 71113640 critical splice acceptor site probably null
R4965:Nlrp1a UTSW 11 71092315 missense possibly damaging 0.94
R5009:Nlrp1a UTSW 11 71122705 missense probably benign 0.08
R5103:Nlrp1a UTSW 11 71099526 missense probably damaging 0.99
R5355:Nlrp1a UTSW 11 71124251 missense probably benign 0.00
R5577:Nlrp1a UTSW 11 71099574 missense probably damaging 1.00
R5892:Nlrp1a UTSW 11 71099645 missense probably damaging 1.00
R5949:Nlrp1a UTSW 11 71098989 missense probably damaging 1.00
R5964:Nlrp1a UTSW 11 71123020 missense probably benign 0.00
R6220:Nlrp1a UTSW 11 71142338 missense probably benign 0.01
R6564:Nlrp1a UTSW 11 71123572 missense probably damaging 1.00
R6586:Nlrp1a UTSW 11 71106073 missense probably benign 0.00
R6925:Nlrp1a UTSW 11 71092513 missense probably null 0.99
R7013:Nlrp1a UTSW 11 71123552 missense probably benign 0.44
R7155:Nlrp1a UTSW 11 71124079 missense possibly damaging 0.93
R7214:Nlrp1a UTSW 11 71123293 missense probably damaging 1.00
R7268:Nlrp1a UTSW 11 71124242 missense probably benign 0.00
R7388:Nlrp1a UTSW 11 71123197 missense probably damaging 1.00
R7404:Nlrp1a UTSW 11 71097093 nonsense probably null
R7409:Nlrp1a UTSW 11 71122808 missense probably benign 0.03
R7410:Nlrp1a UTSW 11 71123857 missense probably damaging 0.99
R7440:Nlrp1a UTSW 11 71092324 missense probably damaging 0.99
R7447:Nlrp1a UTSW 11 71092411 missense probably damaging 1.00
R7450:Nlrp1a UTSW 11 71107658 missense probably damaging 1.00
R7569:Nlrp1a UTSW 11 71109043 missense probably benign 0.00
R7600:Nlrp1a UTSW 11 71098914 missense probably damaging 0.96
R7634:Nlrp1a UTSW 11 71099528 missense probably benign 0.19
R7734:Nlrp1a UTSW 11 71108000 missense unknown
R7747:Nlrp1a UTSW 11 71123408 missense possibly damaging 0.85
R8471:Nlrp1a UTSW 11 71123059 missense possibly damaging 0.68
R8482:Nlrp1a UTSW 11 71109075 splice site probably null
R9008:Nlrp1a UTSW 11 71123909 missense possibly damaging 0.89
R9441:Nlrp1a UTSW 11 71123108 missense probably damaging 1.00
X0026:Nlrp1a UTSW 11 71142316 missense probably benign 0.18
Z1177:Nlrp1a UTSW 11 71123169 missense probably benign 0.27
Z1186:Nlrp1a UTSW 11 71092243 missense probably benign
Z1186:Nlrp1a UTSW 11 71097251 missense probably damaging 0.96
Z1186:Nlrp1a UTSW 11 71099616 missense probably benign
Z1186:Nlrp1a UTSW 11 71124088 missense probably benign
Z1186:Nlrp1a UTSW 11 71142529 critical splice acceptor site probably null
Z1187:Nlrp1a UTSW 11 71092243 missense probably benign
Z1187:Nlrp1a UTSW 11 71097251 missense probably damaging 0.96
Z1187:Nlrp1a UTSW 11 71099616 missense probably benign
Z1187:Nlrp1a UTSW 11 71124088 missense probably benign
Z1187:Nlrp1a UTSW 11 71142529 critical splice acceptor site probably null
Z1188:Nlrp1a UTSW 11 71092243 missense probably benign
Z1188:Nlrp1a UTSW 11 71097251 missense probably damaging 0.96
Z1188:Nlrp1a UTSW 11 71099616 missense probably benign
Z1188:Nlrp1a UTSW 11 71124088 missense probably benign
Z1188:Nlrp1a UTSW 11 71142529 critical splice acceptor site probably null
Z1189:Nlrp1a UTSW 11 71092243 missense probably benign
Z1189:Nlrp1a UTSW 11 71097251 missense probably damaging 0.96
Z1189:Nlrp1a UTSW 11 71099616 missense probably benign
Z1189:Nlrp1a UTSW 11 71124088 missense probably benign
Z1189:Nlrp1a UTSW 11 71142529 critical splice acceptor site probably null
Z1190:Nlrp1a UTSW 11 71092243 missense probably benign
Z1190:Nlrp1a UTSW 11 71097251 missense probably damaging 0.96
Z1190:Nlrp1a UTSW 11 71099616 missense probably benign
Z1190:Nlrp1a UTSW 11 71124088 missense probably benign
Z1190:Nlrp1a UTSW 11 71142529 critical splice acceptor site probably null
Z1191:Nlrp1a UTSW 11 71092243 missense probably benign
Z1191:Nlrp1a UTSW 11 71097251 missense probably damaging 0.96
Z1191:Nlrp1a UTSW 11 71099616 missense probably benign
Z1191:Nlrp1a UTSW 11 71124088 missense probably benign
Z1191:Nlrp1a UTSW 11 71142529 critical splice acceptor site probably null
Z1192:Nlrp1a UTSW 11 71092243 missense probably benign
Z1192:Nlrp1a UTSW 11 71097251 missense probably damaging 0.96
Z1192:Nlrp1a UTSW 11 71099616 missense probably benign
Z1192:Nlrp1a UTSW 11 71124088 missense probably benign
Z1192:Nlrp1a UTSW 11 71142529 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ATCACGTGTGTCAGGAGCTC -3'
(R):5'- TTCCTGAAGATTGGTGTCCTTC -3'

Sequencing Primer
(F):5'- ACGTGTGTCAGGAGCTCCATATC -3'
(R):5'- ATTGGTGTCCTTCAAAAGCAGGC -3'
Posted On 2021-11-19