Incidental Mutation 'R9028:Kif2b'
ID 686887
Institutional Source Beutler Lab
Gene Symbol Kif2b
Ensembl Gene ENSMUSG00000046755
Gene Name kinesin family member 2B
Synonyms 1700063D03Rik
MMRRC Submission 068857-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.775) question?
Stock # R9028 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 91466141-91468384 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 91468011 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 91 (S91P)
Ref Sequence ENSEMBL: ENSMUSP00000058084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061019]
AlphaFold Q8C0N1
Predicted Effect probably benign
Transcript: ENSMUST00000061019
AA Change: S91P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000058084
Gene: ENSMUSG00000046755
AA Change: S91P

DomainStartEndE-ValueType
low complexity region 55 70 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
low complexity region 151 176 N/A INTRINSIC
KISc 211 549 2.34e-134 SMART
low complexity region 588 603 N/A INTRINSIC
coiled coil region 640 664 N/A INTRINSIC
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (74/75)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 77,023,977 (GRCm39) V1066A probably damaging Het
Abca5 T A 11: 110,188,904 (GRCm39) H851L probably damaging Het
Actn2 T C 13: 12,315,864 (GRCm39) I218M possibly damaging Het
Afmid G A 11: 117,727,489 (GRCm39) E338K probably benign Het
Amer3 G A 1: 34,627,758 (GRCm39) V666I probably benign Het
Apol7b A G 15: 77,307,616 (GRCm39) V293A probably damaging Het
Bag6 T A 17: 35,363,130 (GRCm39) S657T probably benign Het
Btaf1 T C 19: 36,946,508 (GRCm39) L438P probably damaging Het
Cdc20 T C 4: 118,293,757 (GRCm39) E126G probably benign Het
Cep97 C T 16: 55,739,915 (GRCm39) W248* probably null Het
Cfap69 A T 5: 5,696,958 (GRCm39) S113T probably benign Het
Cgrrf1 C A 14: 47,091,200 (GRCm39) D241E probably benign Het
Cnksr1 T C 4: 133,960,608 (GRCm39) T280A possibly damaging Het
Cox4i1 T A 8: 121,398,022 (GRCm39) probably benign Het
Cpm T A 10: 117,519,414 (GRCm39) F441I probably benign Het
Cs A C 10: 128,188,952 (GRCm39) M154L Het
Dmrta1 T A 4: 89,579,914 (GRCm39) N291K probably damaging Het
Dnah7a T C 1: 53,560,297 (GRCm39) T2125A probably benign Het
Dock10 A T 1: 80,584,012 (GRCm39) probably benign Het
Dok7 A G 5: 35,236,819 (GRCm39) Y369C probably damaging Het
E130311K13Rik T C 3: 63,822,969 (GRCm39) Y225C probably damaging Het
Elapor1 G A 3: 108,370,819 (GRCm39) T687I probably benign Het
F7 T C 8: 13,076,087 (GRCm39) L10P possibly damaging Het
Faf1 C A 4: 109,748,105 (GRCm39) T470K possibly damaging Het
Fam83h A T 15: 75,875,738 (GRCm39) L533Q possibly damaging Het
Far1 T A 7: 113,146,629 (GRCm39) V129E probably damaging Het
Fgfr4 T C 13: 55,306,967 (GRCm39) Y219H probably damaging Het
Fryl A T 5: 73,255,609 (GRCm39) S807R probably benign Het
Gaa T A 11: 119,161,207 (GRCm39) D83E probably benign Het
Grm2 A G 9: 106,528,384 (GRCm39) S167P possibly damaging Het
H1f11-ps T C 19: 47,159,129 (GRCm39) K149E unknown Het
Hibch T C 1: 52,892,868 (GRCm39) L26P possibly damaging Het
Hspa9 T C 18: 35,075,084 (GRCm39) E415G probably damaging Het
Ipo4 T C 14: 55,866,408 (GRCm39) Y757C probably damaging Het
Itk T A 11: 46,235,710 (GRCm39) probably benign Het
Kdm5a C T 6: 120,416,092 (GRCm39) P1671S probably benign Het
Kif13a G A 13: 46,951,841 (GRCm39) P811S probably damaging Het
Kif23 T C 9: 61,828,341 (GRCm39) E857G probably damaging Het
Letm1 G T 5: 33,909,847 (GRCm39) Q396K probably damaging Het
Map2k6 T A 11: 110,388,799 (GRCm39) M247K Het
Mga A G 2: 119,778,070 (GRCm39) I1872V probably benign Het
Mmp15 A T 8: 96,096,316 (GRCm39) N369I probably benign Het
Myo3a T A 2: 22,490,099 (GRCm39) S1487T possibly damaging Het
Ncam1 T C 9: 49,418,736 (GRCm39) T855A Het
Ncoa2 A G 1: 13,223,079 (GRCm39) V1182A probably benign Het
Nhlrc3 A T 3: 53,360,992 (GRCm39) C254* probably null Het
Nlrp1a C T 11: 71,013,819 (GRCm39) R477H probably benign Het
Nox3 T A 17: 3,716,185 (GRCm39) T407S possibly damaging Het
Or1x6 C T 11: 50,939,660 (GRCm39) T242M probably damaging Het
Or3a1d T C 11: 74,237,747 (GRCm39) Y101C probably damaging Het
Or4c15b T A 2: 89,112,676 (GRCm39) D267V probably damaging Het
Pfkp T A 13: 6,655,725 (GRCm39) I303F probably damaging Het
Pgc T C 17: 48,043,983 (GRCm39) Y292H possibly damaging Het
Phtf2 A G 5: 20,999,373 (GRCm39) Y257H probably benign Het
Pkdrej T C 15: 85,701,098 (GRCm39) N1613D probably damaging Het
Prb1b C T 6: 132,289,618 (GRCm39) E69K unknown Het
Rapgef2 A G 3: 78,981,651 (GRCm39) S1115P probably damaging Het
Rbpj A G 5: 53,807,032 (GRCm39) E260G possibly damaging Het
Rrm1 T A 7: 102,109,605 (GRCm39) N476K probably damaging Het
Slc9a2 T A 1: 40,765,612 (GRCm39) I334N probably damaging Het
Slk T G 19: 47,608,512 (GRCm39) N488K probably benign Het
Smarca5 T C 8: 81,440,642 (GRCm39) I607M probably damaging Het
Sspo G A 6: 48,473,087 (GRCm39) V162M probably benign Het
Svep1 T G 4: 58,145,199 (GRCm39) Q422P possibly damaging Het
Tcn2 C T 11: 3,872,111 (GRCm39) V339I probably damaging Het
Tnfrsf19 T C 14: 61,242,650 (GRCm39) H78R probably benign Het
Trav14-3 C A 14: 54,000,887 (GRCm39) Q33K unknown Het
Ubtd2 T C 11: 32,449,432 (GRCm39) I93T possibly damaging Het
Uhrf2 G A 19: 30,066,744 (GRCm39) probably null Het
Vmn1r224 T G 17: 20,640,112 (GRCm39) S230A possibly damaging Het
Wee2 A T 6: 40,421,189 (GRCm39) H93L probably benign Het
Zdhhc17 T C 10: 110,796,934 (GRCm39) E279G probably damaging Het
Zfp623 T A 15: 75,819,349 (GRCm39) F102I probably damaging Het
Zfpm2 A C 15: 40,966,758 (GRCm39) E1081A possibly damaging Het
Zscan18 A T 7: 12,506,116 (GRCm39) probably benign Het
Other mutations in Kif2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Kif2b APN 11 91,467,206 (GRCm39) missense probably damaging 1.00
IGL01459:Kif2b APN 11 91,467,849 (GRCm39) missense possibly damaging 0.65
IGL01468:Kif2b APN 11 91,467,191 (GRCm39) missense probably damaging 1.00
IGL02897:Kif2b APN 11 91,467,045 (GRCm39) missense probably damaging 1.00
R0076:Kif2b UTSW 11 91,466,735 (GRCm39) missense probably damaging 1.00
R0488:Kif2b UTSW 11 91,467,798 (GRCm39) missense probably benign 0.00
R0524:Kif2b UTSW 11 91,466,550 (GRCm39) missense probably benign 0.00
R0549:Kif2b UTSW 11 91,467,410 (GRCm39) missense probably damaging 1.00
R0893:Kif2b UTSW 11 91,466,420 (GRCm39) missense probably benign 0.16
R1677:Kif2b UTSW 11 91,466,798 (GRCm39) missense probably damaging 1.00
R2025:Kif2b UTSW 11 91,468,172 (GRCm39) missense probably damaging 0.99
R2185:Kif2b UTSW 11 91,467,797 (GRCm39) frame shift probably null
R2290:Kif2b UTSW 11 91,466,522 (GRCm39) missense probably benign 0.00
R4697:Kif2b UTSW 11 91,467,672 (GRCm39) missense probably benign 0.01
R4785:Kif2b UTSW 11 91,467,254 (GRCm39) missense probably benign 0.07
R5429:Kif2b UTSW 11 91,468,055 (GRCm39) missense probably benign 0.03
R5555:Kif2b UTSW 11 91,466,286 (GRCm39) missense probably benign 0.00
R5652:Kif2b UTSW 11 91,466,656 (GRCm39) missense possibly damaging 0.86
R5765:Kif2b UTSW 11 91,468,068 (GRCm39) missense probably benign 0.28
R6101:Kif2b UTSW 11 91,466,814 (GRCm39) missense probably benign 0.00
R6105:Kif2b UTSW 11 91,466,814 (GRCm39) missense probably benign 0.00
R6450:Kif2b UTSW 11 91,467,192 (GRCm39) missense probably damaging 0.99
R6862:Kif2b UTSW 11 91,466,741 (GRCm39) missense probably damaging 1.00
R7097:Kif2b UTSW 11 91,467,650 (GRCm39) missense probably benign 0.00
R7189:Kif2b UTSW 11 91,467,963 (GRCm39) missense probably benign 0.01
R7507:Kif2b UTSW 11 91,468,269 (GRCm39) missense probably benign
R7742:Kif2b UTSW 11 91,467,411 (GRCm39) missense possibly damaging 0.85
R7818:Kif2b UTSW 11 91,466,952 (GRCm39) missense probably damaging 1.00
R7820:Kif2b UTSW 11 91,468,100 (GRCm39) missense probably benign 0.01
R7946:Kif2b UTSW 11 91,466,571 (GRCm39) missense probably benign 0.00
R8378:Kif2b UTSW 11 91,467,201 (GRCm39) missense possibly damaging 0.95
R8442:Kif2b UTSW 11 91,467,140 (GRCm39) missense possibly damaging 0.54
R8925:Kif2b UTSW 11 91,468,023 (GRCm39) missense probably benign 0.00
R8927:Kif2b UTSW 11 91,468,023 (GRCm39) missense probably benign 0.00
R8969:Kif2b UTSW 11 91,468,019 (GRCm39) missense probably benign 0.00
R9002:Kif2b UTSW 11 91,467,053 (GRCm39) missense probably benign 0.30
R9039:Kif2b UTSW 11 91,467,131 (GRCm39) missense possibly damaging 0.91
R9063:Kif2b UTSW 11 91,466,654 (GRCm39) missense probably damaging 1.00
R9114:Kif2b UTSW 11 91,466,538 (GRCm39) missense possibly damaging 0.77
R9279:Kif2b UTSW 11 91,467,975 (GRCm39) missense probably benign 0.01
Z1176:Kif2b UTSW 11 91,467,090 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCGGATCTCTAGCTGCAGTC -3'
(R):5'- GCGCAGTGACAAACGGATTC -3'

Sequencing Primer
(F):5'- GCAGCTTTTCAATTTCCCGTAG -3'
(R):5'- AAACGGATTCACCTGGCTGTG -3'
Posted On 2021-11-19