Incidental Mutation 'R9028:Abca5'
ID 686888
Institutional Source Beutler Lab
Gene Symbol Abca5
Ensembl Gene ENSMUSG00000018800
Gene Name ATP-binding cassette, sub-family A member 5
Synonyms ABC13, B930033A02Rik
MMRRC Submission 068857-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.119) question?
Stock # R9028 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 110160195-110228542 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 110188904 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 851 (H851L)
Ref Sequence ENSEMBL: ENSMUSP00000047927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043961] [ENSMUST00000124714]
AlphaFold Q8K448
Predicted Effect probably damaging
Transcript: ENSMUST00000043961
AA Change: H851L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047927
Gene: ENSMUSG00000018800
AA Change: H851L

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 29 416 4.3e-33 PFAM
AAA 506 691 2.88e-8 SMART
low complexity region 733 744 N/A INTRINSIC
transmembrane domain 864 886 N/A INTRINSIC
transmembrane domain 971 993 N/A INTRINSIC
low complexity region 1262 1267 N/A INTRINSIC
AAA 1325 1512 3.52e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000124714
AA Change: H851L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120708
Gene: ENSMUSG00000018800
AA Change: H851L

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 30 416 9.5e-32 PFAM
AAA 506 691 2.88e-8 SMART
low complexity region 733 744 N/A INTRINSIC
transmembrane domain 864 886 N/A INTRINSIC
transmembrane domain 971 993 N/A INTRINSIC
transmembrane domain 1019 1041 N/A INTRINSIC
transmembrane domain 1074 1096 N/A INTRINSIC
transmembrane domain 1103 1125 N/A INTRINSIC
transmembrane domain 1136 1158 N/A INTRINSIC
transmembrane domain 1165 1187 N/A INTRINSIC
Meta Mutation Damage Score 0.6832 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This encoded protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This gene is clustered among 4 other ABC1 family members on 17q24, but neither the substrate nor the function of this gene is known. Alternative splicing of this gene results in several transcript variants; however, not all variants have been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit exophthalmos, tremors and collapse of the thyroid gland, and develop a dilated cardiomyopathy with large thrombi due to depression of the cardiac function. Severe edema, liver injury and premature death appear to be sensitive to genetic background. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 77,023,977 (GRCm39) V1066A probably damaging Het
Actn2 T C 13: 12,315,864 (GRCm39) I218M possibly damaging Het
Afmid G A 11: 117,727,489 (GRCm39) E338K probably benign Het
Amer3 G A 1: 34,627,758 (GRCm39) V666I probably benign Het
Apol7b A G 15: 77,307,616 (GRCm39) V293A probably damaging Het
Bag6 T A 17: 35,363,130 (GRCm39) S657T probably benign Het
Btaf1 T C 19: 36,946,508 (GRCm39) L438P probably damaging Het
Cdc20 T C 4: 118,293,757 (GRCm39) E126G probably benign Het
Cep97 C T 16: 55,739,915 (GRCm39) W248* probably null Het
Cfap69 A T 5: 5,696,958 (GRCm39) S113T probably benign Het
Cgrrf1 C A 14: 47,091,200 (GRCm39) D241E probably benign Het
Cnksr1 T C 4: 133,960,608 (GRCm39) T280A possibly damaging Het
Cox4i1 T A 8: 121,398,022 (GRCm39) probably benign Het
Cpm T A 10: 117,519,414 (GRCm39) F441I probably benign Het
Cs A C 10: 128,188,952 (GRCm39) M154L Het
Dmrta1 T A 4: 89,579,914 (GRCm39) N291K probably damaging Het
Dnah7a T C 1: 53,560,297 (GRCm39) T2125A probably benign Het
Dock10 A T 1: 80,584,012 (GRCm39) probably benign Het
Dok7 A G 5: 35,236,819 (GRCm39) Y369C probably damaging Het
E130311K13Rik T C 3: 63,822,969 (GRCm39) Y225C probably damaging Het
Elapor1 G A 3: 108,370,819 (GRCm39) T687I probably benign Het
F7 T C 8: 13,076,087 (GRCm39) L10P possibly damaging Het
Faf1 C A 4: 109,748,105 (GRCm39) T470K possibly damaging Het
Fam83h A T 15: 75,875,738 (GRCm39) L533Q possibly damaging Het
Far1 T A 7: 113,146,629 (GRCm39) V129E probably damaging Het
Fgfr4 T C 13: 55,306,967 (GRCm39) Y219H probably damaging Het
Fryl A T 5: 73,255,609 (GRCm39) S807R probably benign Het
Gaa T A 11: 119,161,207 (GRCm39) D83E probably benign Het
Grm2 A G 9: 106,528,384 (GRCm39) S167P possibly damaging Het
H1f11-ps T C 19: 47,159,129 (GRCm39) K149E unknown Het
Hibch T C 1: 52,892,868 (GRCm39) L26P possibly damaging Het
Hspa9 T C 18: 35,075,084 (GRCm39) E415G probably damaging Het
Ipo4 T C 14: 55,866,408 (GRCm39) Y757C probably damaging Het
Itk T A 11: 46,235,710 (GRCm39) probably benign Het
Kdm5a C T 6: 120,416,092 (GRCm39) P1671S probably benign Het
Kif13a G A 13: 46,951,841 (GRCm39) P811S probably damaging Het
Kif23 T C 9: 61,828,341 (GRCm39) E857G probably damaging Het
Kif2b A G 11: 91,468,011 (GRCm39) S91P probably benign Het
Letm1 G T 5: 33,909,847 (GRCm39) Q396K probably damaging Het
Map2k6 T A 11: 110,388,799 (GRCm39) M247K Het
Mga A G 2: 119,778,070 (GRCm39) I1872V probably benign Het
Mmp15 A T 8: 96,096,316 (GRCm39) N369I probably benign Het
Myo3a T A 2: 22,490,099 (GRCm39) S1487T possibly damaging Het
Ncam1 T C 9: 49,418,736 (GRCm39) T855A Het
Ncoa2 A G 1: 13,223,079 (GRCm39) V1182A probably benign Het
Nhlrc3 A T 3: 53,360,992 (GRCm39) C254* probably null Het
Nlrp1a C T 11: 71,013,819 (GRCm39) R477H probably benign Het
Nox3 T A 17: 3,716,185 (GRCm39) T407S possibly damaging Het
Or1x6 C T 11: 50,939,660 (GRCm39) T242M probably damaging Het
Or3a1d T C 11: 74,237,747 (GRCm39) Y101C probably damaging Het
Or4c15b T A 2: 89,112,676 (GRCm39) D267V probably damaging Het
Pfkp T A 13: 6,655,725 (GRCm39) I303F probably damaging Het
Pgc T C 17: 48,043,983 (GRCm39) Y292H possibly damaging Het
Phtf2 A G 5: 20,999,373 (GRCm39) Y257H probably benign Het
Pkdrej T C 15: 85,701,098 (GRCm39) N1613D probably damaging Het
Prb1b C T 6: 132,289,618 (GRCm39) E69K unknown Het
Rapgef2 A G 3: 78,981,651 (GRCm39) S1115P probably damaging Het
Rbpj A G 5: 53,807,032 (GRCm39) E260G possibly damaging Het
Rrm1 T A 7: 102,109,605 (GRCm39) N476K probably damaging Het
Slc9a2 T A 1: 40,765,612 (GRCm39) I334N probably damaging Het
Slk T G 19: 47,608,512 (GRCm39) N488K probably benign Het
Smarca5 T C 8: 81,440,642 (GRCm39) I607M probably damaging Het
Sspo G A 6: 48,473,087 (GRCm39) V162M probably benign Het
Svep1 T G 4: 58,145,199 (GRCm39) Q422P possibly damaging Het
Tcn2 C T 11: 3,872,111 (GRCm39) V339I probably damaging Het
Tnfrsf19 T C 14: 61,242,650 (GRCm39) H78R probably benign Het
Trav14-3 C A 14: 54,000,887 (GRCm39) Q33K unknown Het
Ubtd2 T C 11: 32,449,432 (GRCm39) I93T possibly damaging Het
Uhrf2 G A 19: 30,066,744 (GRCm39) probably null Het
Vmn1r224 T G 17: 20,640,112 (GRCm39) S230A possibly damaging Het
Wee2 A T 6: 40,421,189 (GRCm39) H93L probably benign Het
Zdhhc17 T C 10: 110,796,934 (GRCm39) E279G probably damaging Het
Zfp623 T A 15: 75,819,349 (GRCm39) F102I probably damaging Het
Zfpm2 A C 15: 40,966,758 (GRCm39) E1081A possibly damaging Het
Zscan18 A T 7: 12,506,116 (GRCm39) probably benign Het
Other mutations in Abca5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Abca5 APN 11 110,200,276 (GRCm39) critical splice acceptor site probably null
IGL00675:Abca5 APN 11 110,195,811 (GRCm39) missense probably damaging 1.00
IGL01512:Abca5 APN 11 110,208,649 (GRCm39) missense probably benign 0.40
IGL01559:Abca5 APN 11 110,163,352 (GRCm39) missense probably benign
IGL01584:Abca5 APN 11 110,195,749 (GRCm39) missense probably damaging 0.98
IGL01604:Abca5 APN 11 110,168,462 (GRCm39) missense possibly damaging 0.47
IGL01828:Abca5 APN 11 110,178,521 (GRCm39) missense probably benign
IGL01880:Abca5 APN 11 110,184,089 (GRCm39) missense probably benign 0.01
IGL02054:Abca5 APN 11 110,182,949 (GRCm39) missense probably damaging 0.99
IGL02074:Abca5 APN 11 110,184,176 (GRCm39) missense probably benign 0.00
IGL02233:Abca5 APN 11 110,165,170 (GRCm39) nonsense probably null
IGL02245:Abca5 APN 11 110,188,995 (GRCm39) nonsense probably null
IGL02317:Abca5 APN 11 110,218,587 (GRCm39) missense probably benign 0.09
IGL02352:Abca5 APN 11 110,166,156 (GRCm39) missense probably benign 0.01
IGL02359:Abca5 APN 11 110,166,156 (GRCm39) missense probably benign 0.01
IGL02390:Abca5 APN 11 110,187,377 (GRCm39) missense probably benign
IGL02600:Abca5 APN 11 110,200,264 (GRCm39) missense probably benign 0.02
IGL02639:Abca5 APN 11 110,178,899 (GRCm39) missense possibly damaging 0.79
IGL03000:Abca5 APN 11 110,208,640 (GRCm39) missense probably benign 0.04
IGL03074:Abca5 APN 11 110,201,101 (GRCm39) missense probably benign 0.01
IGL03078:Abca5 APN 11 110,167,371 (GRCm39) nonsense probably null
IGL03342:Abca5 APN 11 110,178,517 (GRCm39) missense possibly damaging 0.94
IGL03368:Abca5 APN 11 110,204,348 (GRCm39) splice site probably benign
atles UTSW 11 110,190,755 (GRCm39) missense probably damaging 0.99
Demento UTSW 11 110,201,059 (GRCm39) missense probably damaging 1.00
jones UTSW 11 110,178,884 (GRCm39) splice site probably null
smith UTSW 11 110,192,371 (GRCm39) missense probably benign 0.22
R0106:Abca5 UTSW 11 110,210,651 (GRCm39) missense probably damaging 1.00
R0116:Abca5 UTSW 11 110,167,331 (GRCm39) missense probably damaging 1.00
R0305:Abca5 UTSW 11 110,164,137 (GRCm39) splice site probably benign
R0550:Abca5 UTSW 11 110,184,666 (GRCm39) missense probably damaging 1.00
R0578:Abca5 UTSW 11 110,167,315 (GRCm39) nonsense probably null
R0587:Abca5 UTSW 11 110,202,203 (GRCm39) missense probably benign 0.00
R0610:Abca5 UTSW 11 110,192,353 (GRCm39) missense probably benign 0.00
R0617:Abca5 UTSW 11 110,170,515 (GRCm39) missense probably damaging 0.98
R0667:Abca5 UTSW 11 110,218,637 (GRCm39) missense probably benign 0.00
R0844:Abca5 UTSW 11 110,210,658 (GRCm39) missense probably benign 0.00
R1273:Abca5 UTSW 11 110,217,491 (GRCm39) missense probably benign 0.01
R1463:Abca5 UTSW 11 110,205,384 (GRCm39) missense probably damaging 1.00
R1511:Abca5 UTSW 11 110,190,812 (GRCm39) missense possibly damaging 0.73
R1511:Abca5 UTSW 11 110,190,804 (GRCm39) missense probably damaging 1.00
R1687:Abca5 UTSW 11 110,184,714 (GRCm39) missense probably benign 0.32
R1759:Abca5 UTSW 11 110,184,674 (GRCm39) missense probably benign
R1870:Abca5 UTSW 11 110,220,043 (GRCm39) missense probably benign 0.33
R2006:Abca5 UTSW 11 110,204,275 (GRCm39) missense probably benign
R2039:Abca5 UTSW 11 110,190,755 (GRCm39) missense probably damaging 0.99
R2076:Abca5 UTSW 11 110,178,478 (GRCm39) missense probably benign 0.10
R2136:Abca5 UTSW 11 110,210,658 (GRCm39) missense probably benign 0.00
R2154:Abca5 UTSW 11 110,183,000 (GRCm39) missense probably benign 0.00
R2273:Abca5 UTSW 11 110,166,107 (GRCm39) missense possibly damaging 0.93
R2274:Abca5 UTSW 11 110,166,107 (GRCm39) missense possibly damaging 0.93
R2275:Abca5 UTSW 11 110,166,107 (GRCm39) missense possibly damaging 0.93
R2328:Abca5 UTSW 11 110,167,347 (GRCm39) missense probably damaging 0.99
R3702:Abca5 UTSW 11 110,178,884 (GRCm39) splice site probably null
R3768:Abca5 UTSW 11 110,204,217 (GRCm39) missense probably benign 0.01
R3872:Abca5 UTSW 11 110,201,059 (GRCm39) missense probably damaging 1.00
R3873:Abca5 UTSW 11 110,201,059 (GRCm39) missense probably damaging 1.00
R3874:Abca5 UTSW 11 110,201,059 (GRCm39) missense probably damaging 1.00
R3875:Abca5 UTSW 11 110,201,059 (GRCm39) missense probably damaging 1.00
R4347:Abca5 UTSW 11 110,190,794 (GRCm39) missense probably damaging 1.00
R4429:Abca5 UTSW 11 110,202,236 (GRCm39) missense probably benign 0.00
R4790:Abca5 UTSW 11 110,202,236 (GRCm39) missense possibly damaging 0.63
R4812:Abca5 UTSW 11 110,192,647 (GRCm39) missense probably damaging 1.00
R4833:Abca5 UTSW 11 110,170,142 (GRCm39) missense probably benign 0.00
R4883:Abca5 UTSW 11 110,217,457 (GRCm39) missense probably damaging 1.00
R5000:Abca5 UTSW 11 110,201,050 (GRCm39) missense probably damaging 1.00
R5004:Abca5 UTSW 11 110,170,202 (GRCm39) missense probably damaging 0.99
R5066:Abca5 UTSW 11 110,200,176 (GRCm39) intron probably benign
R5230:Abca5 UTSW 11 110,210,686 (GRCm39) missense probably benign
R5321:Abca5 UTSW 11 110,218,651 (GRCm39) missense probably benign
R5350:Abca5 UTSW 11 110,210,622 (GRCm39) nonsense probably null
R5414:Abca5 UTSW 11 110,205,448 (GRCm39) missense probably damaging 1.00
R5437:Abca5 UTSW 11 110,210,622 (GRCm39) nonsense probably null
R5451:Abca5 UTSW 11 110,210,622 (GRCm39) nonsense probably null
R5453:Abca5 UTSW 11 110,210,622 (GRCm39) nonsense probably null
R5488:Abca5 UTSW 11 110,183,009 (GRCm39) missense probably benign 0.00
R5636:Abca5 UTSW 11 110,192,362 (GRCm39) missense probably benign 0.00
R5805:Abca5 UTSW 11 110,170,216 (GRCm39) missense probably benign 0.06
R5900:Abca5 UTSW 11 110,169,982 (GRCm39) missense possibly damaging 0.92
R6152:Abca5 UTSW 11 110,204,187 (GRCm39) missense probably damaging 1.00
R6167:Abca5 UTSW 11 110,182,931 (GRCm39) missense probably benign 0.10
R6343:Abca5 UTSW 11 110,205,378 (GRCm39) missense probably damaging 1.00
R6425:Abca5 UTSW 11 110,220,058 (GRCm39) missense possibly damaging 0.75
R6493:Abca5 UTSW 11 110,184,704 (GRCm39) missense probably benign 0.00
R6498:Abca5 UTSW 11 110,182,928 (GRCm39) missense possibly damaging 0.70
R6884:Abca5 UTSW 11 110,220,043 (GRCm39) missense probably damaging 0.96
R6912:Abca5 UTSW 11 110,197,106 (GRCm39) missense probably benign 0.35
R7084:Abca5 UTSW 11 110,192,371 (GRCm39) missense probably benign 0.22
R7239:Abca5 UTSW 11 110,217,530 (GRCm39) missense possibly damaging 0.94
R7490:Abca5 UTSW 11 110,168,437 (GRCm39) missense possibly damaging 0.95
R7527:Abca5 UTSW 11 110,218,556 (GRCm39) critical splice donor site probably null
R7702:Abca5 UTSW 11 110,167,278 (GRCm39) critical splice donor site probably null
R7763:Abca5 UTSW 11 110,163,323 (GRCm39) missense possibly damaging 0.85
R8237:Abca5 UTSW 11 110,200,981 (GRCm39) missense probably benign 0.01
R8910:Abca5 UTSW 11 110,189,030 (GRCm39) missense probably damaging 0.96
R9124:Abca5 UTSW 11 110,189,005 (GRCm39) missense possibly damaging 0.91
R9151:Abca5 UTSW 11 110,188,908 (GRCm39) missense probably benign
R9187:Abca5 UTSW 11 110,200,961 (GRCm39) critical splice donor site probably null
R9249:Abca5 UTSW 11 110,220,165 (GRCm39) intron probably benign
R9322:Abca5 UTSW 11 110,192,331 (GRCm39) missense probably damaging 0.96
R9391:Abca5 UTSW 11 110,178,542 (GRCm39) missense probably benign
R9435:Abca5 UTSW 11 110,182,911 (GRCm39) critical splice donor site probably null
R9557:Abca5 UTSW 11 110,197,109 (GRCm39) missense probably damaging 1.00
R9660:Abca5 UTSW 11 110,168,248 (GRCm39) missense possibly damaging 0.80
R9788:Abca5 UTSW 11 110,192,253 (GRCm39) missense probably damaging 1.00
RF014:Abca5 UTSW 11 110,170,580 (GRCm39) critical splice acceptor site probably null
Z1177:Abca5 UTSW 11 110,170,154 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TTAGACAGACAGACAGCCGG -3'
(R):5'- CCACTTGCAGACATGTGCTG -3'

Sequencing Primer
(F):5'- CAGACAGCCGGATGATAAGAATG -3'
(R):5'- CATGTGCTGTCATGTTGATGG -3'
Posted On 2021-11-19