Mutagenetix > Incidental Mutation

Incidental Mutation 'R9028:Abca5'

686888

Institutional Source

Beutler Lab

Gene Symbol

Abca5

Ensembl Gene

ENSMUSG00000018800

Gene Name

ATP-binding cassette, sub-family A (ABC1), member 5

Synonyms

ABC13, B930033A02Rik

MMRRC Submission

Accession Numbers

NCBI RefSeq: NM_147219.2; MGI: 2386607

Essential gene?

Probably non essential (E-score: 0.150) question?

Stock #

R9028 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

110269369-110337716 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 110298078 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 851 (H851L)

Ref Sequence

ENSEMBL: ENSMUSP00000047927 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043961] [ENSMUST00000124714]

AlphaFold

Q8K448

Predicted Effect

probably damaging
Transcript: ENSMUST00000043961
AA Change: H851L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000047927
Gene: ENSMUSG00000018800
AA Change: H851L

Domain	Start	End	E-Value	Type
Pfam:ABC2_membrane_3	29	416	4.3e-33	PFAM
AAA	506	691	2.88e-8	SMART
low complexity region	733	744	N/A	INTRINSIC
transmembrane domain	864	886	N/A	INTRINSIC
transmembrane domain	971	993	N/A	INTRINSIC
low complexity region	1262	1267	N/A	INTRINSIC
AAA	1325	1512	3.52e-3	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000124714
AA Change: H851L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000120708
Gene: ENSMUSG00000018800
AA Change: H851L

Domain	Start	End	E-Value	Type
Pfam:ABC2_membrane_3	30	416	9.5e-32	PFAM
AAA	506	691	2.88e-8	SMART
low complexity region	733	744	N/A	INTRINSIC
transmembrane domain	864	886	N/A	INTRINSIC
transmembrane domain	971	993	N/A	INTRINSIC
transmembrane domain	1019	1041	N/A	INTRINSIC
transmembrane domain	1074	1096	N/A	INTRINSIC
transmembrane domain	1103	1125	N/A	INTRINSIC
transmembrane domain	1136	1158	N/A	INTRINSIC
transmembrane domain	1165	1187	N/A	INTRINSIC

Meta Mutation Damage Score

0.6832

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

99% (74/75)

MGI Phenotype

Strain: 3581814
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This encoded protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This gene is clustered among 4 other ABC1 family members on 17q24, but neither the substrate nor the function of this gene is known. Alternative splicing of this gene results in several transcript variants; however, not all variants have been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit exophthalmos, tremors and collapse of the thyroid gland, and develop a dilated cardiomyopathy with large thrombi due to depression of the cardiac function. Severe edema, liver injury and premature death appear to be sensitive to genetic background. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5330417C22Rik	G	A	3: 108,463,503	T687I	probably benign	Het
Aasdh	A	G	5: 76,876,130	V1066A	probably damaging	Het
Actn2	T	C	13: 12,300,978	I218M	possibly damaging	Het
Afmid	G	A	11: 117,836,663	E338K	probably benign	Het
Amer3	G	A	1: 34,588,677	V666I	probably benign	Het
Apol7b	A	G	15: 77,423,416	V293A	probably damaging	Het
Bag6	T	A	17: 35,144,154	S657T	probably benign	Het
Btaf1	T	C	19: 36,969,108	L438P	probably damaging	Het
Cdc20	T	C	4: 118,436,560	E126G	probably benign	Het
Cep97	C	T	16: 55,919,552	W248*	probably null	Het
Cfap69	A	T	5: 5,646,958	S113T	probably benign	Het
Cgrrf1	C	A	14: 46,853,743	D241E	probably benign	Het
Cnksr1	T	C	4: 134,233,297	T280A	possibly damaging	Het
Cox4i1	T	A	8: 120,671,283		probably benign	Het
Cpm	T	A	10: 117,683,509	F441I	probably benign	Het
Cs	A	C	10: 128,353,083	M154L		Het
Dmrta1	T	A	4: 89,691,677	N291K	probably damaging	Het
Dnah7a	T	C	1: 53,521,138	T2125A	probably benign	Het
Dock10	A	T	1: 80,606,295		probably benign	Het
Dok7	A	G	5: 35,079,475	Y369C	probably damaging	Het
E130311K13Rik	T	C	3: 63,915,548	Y225C	probably damaging	Het
F7	T	C	8: 13,026,087	L10P	possibly damaging	Het
Faf1	C	A	4: 109,890,908	T470K	possibly damaging	Het
Fam83h	A	T	15: 76,003,889	L533Q	possibly damaging	Het
Far1	T	A	7: 113,547,422	V129E	probably damaging	Het
Fgfr4	T	C	13: 55,159,154	Y219H	probably damaging	Het
Fryl	A	T	5: 73,098,266	S807R	probably benign	Het
Gaa	T	A	11: 119,270,381	D83E	probably benign	Het
Gm6970	T	C	19: 47,170,690	K149E	unknown	Het
Grm2	A	G	9: 106,651,185	S167P	possibly damaging	Het
Hibch	T	C	1: 52,853,709	L26P	possibly damaging	Het
Hspa9	T	C	18: 34,942,031	E415G	probably damaging	Het
Ipo4	T	C	14: 55,628,951	Y757C	probably damaging	Het
Itk	T	A	11: 46,344,883		probably benign	Het
Kdm5a	C	T	6: 120,439,131	P1671S	probably benign	Het
Kif13a	G	A	13: 46,798,365	P811S	probably damaging	Het
Kif23	T	C	9: 61,921,059	E857G	probably damaging	Het
Kif2b	A	G	11: 91,577,185	S91P	probably benign	Het
Letm1	G	T	5: 33,752,503	Q396K	probably damaging	Het
Map2k6	T	A	11: 110,497,973	M247K		Het
Mga	A	G	2: 119,947,589	I1872V	probably benign	Het
Mmp15	A	T	8: 95,369,688	N369I	probably benign	Het
Myo3a	T	A	2: 22,600,087	S1487T	possibly damaging	Het
Ncam1	T	C	9: 49,507,436	T855A		Het
Ncoa2	A	G	1: 13,152,855	V1182A	probably benign	Het
Nhlrc3	A	T	3: 53,453,571	C254*	probably null	Het
Nlrp1a	C	T	11: 71,122,993	R477H	probably benign	Het
Nox3	T	A	17: 3,665,910	T407S	possibly damaging	Het
Olfr1229	T	A	2: 89,282,332	D267V	probably damaging	Het
Olfr1375	C	T	11: 51,048,833	T242M	probably damaging	Het
Olfr411	T	C	11: 74,346,921	Y101C	probably damaging	Het
Pfkp	T	A	13: 6,605,689	I303F	probably damaging	Het
Pgc	T	C	17: 47,733,058	Y292H	possibly damaging	Het
Phtf2	A	G	5: 20,794,375	Y257H	probably benign	Het
Pkdrej	T	C	15: 85,816,897	N1613D	probably damaging	Het
Prpmp5	C	T	6: 132,312,655	E69K	unknown	Het
Rapgef2	A	G	3: 79,074,344	S1115P	probably damaging	Het
Rbpj	A	G	5: 53,649,690	E260G	possibly damaging	Het
Rrm1	T	A	7: 102,460,398	N476K	probably damaging	Het
Slc9a2	T	A	1: 40,726,452	I334N	probably damaging	Het
Slk	T	G	19: 47,620,073	N488K	probably benign	Het
Smarca5	T	C	8: 80,714,013	I607M	probably damaging	Het
Sspo	G	A	6: 48,496,153	V162M	probably benign	Het
Svep1	T	G	4: 58,145,199	Q422P	possibly damaging	Het
Tcn2	C	T	11: 3,922,111	V339I	probably damaging	Het
Tnfrsf19	T	C	14: 61,005,201	H78R	probably benign	Het
Trav14-3	C	A	14: 53,763,430	Q33K	unknown	Het
Ubtd2	T	C	11: 32,499,432	I93T	possibly damaging	Het
Uhrf2	G	A	19: 30,089,344		probably null	Het
Vmn1r224	T	G	17: 20,419,850	S230A	possibly damaging	Het
Wee2	A	T	6: 40,444,255	H93L	probably benign	Het
Zdhhc17	T	C	10: 110,961,073	E279G	probably damaging	Het
Zfp623	T	A	15: 75,947,500	F102I	probably damaging	Het
Zfpm2	A	C	15: 41,103,362	E1081A	possibly damaging	Het
Zscan18	A	T	7: 12,772,189		probably benign	Het

Other mutations in Abca5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00487:Abca5	APN	11	110309450	critical splice acceptor site	probably null
IGL00675:Abca5	APN	11	110304985	missense	probably damaging	1.00
IGL01512:Abca5	APN	11	110317823	missense	probably benign	0.40
IGL01559:Abca5	APN	11	110272526	missense	probably benign
IGL01584:Abca5	APN	11	110304923	missense	probably damaging	0.98
IGL01604:Abca5	APN	11	110277636	missense	possibly damaging	0.47
IGL01828:Abca5	APN	11	110287695	missense	probably benign
IGL01880:Abca5	APN	11	110293263	missense	probably benign	0.01
IGL02054:Abca5	APN	11	110292123	missense	probably damaging	0.99
IGL02074:Abca5	APN	11	110293350	missense	probably benign	0.00
IGL02233:Abca5	APN	11	110274344	nonsense	probably null
IGL02245:Abca5	APN	11	110298169	nonsense	probably null
IGL02317:Abca5	APN	11	110327761	missense	probably benign	0.09
IGL02352:Abca5	APN	11	110275330	missense	probably benign	0.01
IGL02359:Abca5	APN	11	110275330	missense	probably benign	0.01
IGL02390:Abca5	APN	11	110296551	missense	probably benign
IGL02600:Abca5	APN	11	110309438	missense	probably benign	0.02
IGL02639:Abca5	APN	11	110288073	missense	possibly damaging	0.79
IGL03000:Abca5	APN	11	110317814	missense	probably benign	0.04
IGL03074:Abca5	APN	11	110310275	missense	probably benign	0.01
IGL03078:Abca5	APN	11	110276545	nonsense	probably null
IGL03342:Abca5	APN	11	110287691	missense	possibly damaging	0.94
IGL03368:Abca5	APN	11	110313522	splice site	probably benign
atles	UTSW	11	110299929	missense	probably damaging	0.99
Demento	UTSW	11	110310233	missense	probably damaging	1.00
jones	UTSW	11	110288058	splice site	probably null
smith	UTSW	11	110301545	missense	probably benign	0.22
R0106:Abca5	UTSW	11	110319825	missense	probably damaging	1.00
R0116:Abca5	UTSW	11	110276505	missense	probably damaging	1.00
R0305:Abca5	UTSW	11	110273311	splice site	probably benign
R0550:Abca5	UTSW	11	110293840	missense	probably damaging	1.00
R0578:Abca5	UTSW	11	110276489	nonsense	probably null
R0587:Abca5	UTSW	11	110311377	missense	probably benign	0.00
R0610:Abca5	UTSW	11	110301527	missense	probably benign	0.00
R0617:Abca5	UTSW	11	110279689	missense	probably damaging	0.98
R0667:Abca5	UTSW	11	110327811	missense	probably benign	0.00
R0844:Abca5	UTSW	11	110319832	missense	probably benign	0.00
R1273:Abca5	UTSW	11	110326665	missense	probably benign	0.01
R1463:Abca5	UTSW	11	110314558	missense	probably damaging	1.00
R1511:Abca5	UTSW	11	110299978	missense	probably damaging	1.00
R1511:Abca5	UTSW	11	110299986	missense	possibly damaging	0.73
R1687:Abca5	UTSW	11	110293888	missense	probably benign	0.32
R1759:Abca5	UTSW	11	110293848	missense	probably benign
R1870:Abca5	UTSW	11	110329217	missense	probably benign	0.33
R2006:Abca5	UTSW	11	110313449	missense	probably benign
R2039:Abca5	UTSW	11	110299929	missense	probably damaging	0.99
R2076:Abca5	UTSW	11	110287652	missense	probably benign	0.10
R2136:Abca5	UTSW	11	110319832	missense	probably benign	0.00
R2154:Abca5	UTSW	11	110292174	missense	probably benign	0.00
R2273:Abca5	UTSW	11	110275281	missense	possibly damaging	0.93
R2274:Abca5	UTSW	11	110275281	missense	possibly damaging	0.93
R2275:Abca5	UTSW	11	110275281	missense	possibly damaging	0.93
R2328:Abca5	UTSW	11	110276521	missense	probably damaging	0.99
R3702:Abca5	UTSW	11	110288058	splice site	probably null
R3768:Abca5	UTSW	11	110313391	missense	probably benign	0.01
R3872:Abca5	UTSW	11	110310233	missense	probably damaging	1.00
R3873:Abca5	UTSW	11	110310233	missense	probably damaging	1.00
R3874:Abca5	UTSW	11	110310233	missense	probably damaging	1.00
R3875:Abca5	UTSW	11	110310233	missense	probably damaging	1.00
R4347:Abca5	UTSW	11	110299968	missense	probably damaging	1.00
R4429:Abca5	UTSW	11	110311410	missense	probably benign	0.00
R4790:Abca5	UTSW	11	110311410	missense	possibly damaging	0.63
R4812:Abca5	UTSW	11	110301821	missense	probably damaging	1.00
R4833:Abca5	UTSW	11	110279316	missense	probably benign	0.00
R4883:Abca5	UTSW	11	110326631	missense	probably damaging	1.00
R5000:Abca5	UTSW	11	110310224	missense	probably damaging	1.00
R5004:Abca5	UTSW	11	110279376	missense	probably damaging	0.99
R5066:Abca5	UTSW	11	110309350	intron	probably benign
R5230:Abca5	UTSW	11	110319860	missense	probably benign
R5321:Abca5	UTSW	11	110327825	missense	probably benign
R5350:Abca5	UTSW	11	110319796	nonsense	probably null
R5414:Abca5	UTSW	11	110314622	missense	probably damaging	1.00
R5437:Abca5	UTSW	11	110319796	nonsense	probably null
R5451:Abca5	UTSW	11	110319796	nonsense	probably null
R5453:Abca5	UTSW	11	110319796	nonsense	probably null
R5488:Abca5	UTSW	11	110292183	missense	probably benign	0.00
R5636:Abca5	UTSW	11	110301536	missense	probably benign	0.00
R5805:Abca5	UTSW	11	110279390	missense	probably benign	0.06
R5900:Abca5	UTSW	11	110279156	missense	possibly damaging	0.92
R6152:Abca5	UTSW	11	110313361	missense	probably damaging	1.00
R6167:Abca5	UTSW	11	110292105	missense	probably benign	0.10
R6343:Abca5	UTSW	11	110314552	missense	probably damaging	1.00
R6425:Abca5	UTSW	11	110329232	missense	possibly damaging	0.75
R6493:Abca5	UTSW	11	110293878	missense	probably benign	0.00
R6498:Abca5	UTSW	11	110292102	missense	possibly damaging	0.70
R6884:Abca5	UTSW	11	110329217	missense	probably damaging	0.96
R6912:Abca5	UTSW	11	110306280	missense	probably benign	0.35
R7084:Abca5	UTSW	11	110301545	missense	probably benign	0.22
R7239:Abca5	UTSW	11	110326704	missense	possibly damaging	0.94
R7490:Abca5	UTSW	11	110277611	missense	possibly damaging	0.95
R7527:Abca5	UTSW	11	110327730	critical splice donor site	probably null
R7702:Abca5	UTSW	11	110276452	critical splice donor site	probably null
R7763:Abca5	UTSW	11	110272497	missense	possibly damaging	0.85
R8237:Abca5	UTSW	11	110310155	missense	probably benign	0.01
R8910:Abca5	UTSW	11	110298204	missense	probably damaging	0.96
R9124:Abca5	UTSW	11	110298179	missense	possibly damaging	0.91
R9151:Abca5	UTSW	11	110298082	missense	probably benign
R9187:Abca5	UTSW	11	110310135	critical splice donor site	probably null
R9249:Abca5	UTSW	11	110329339	intron	probably benign
R9322:Abca5	UTSW	11	110301505	missense	probably damaging	0.96
R9391:Abca5	UTSW	11	110287716	missense	probably benign
R9435:Abca5	UTSW	11	110292085	critical splice donor site	probably null
R9557:Abca5	UTSW	11	110306283	missense	probably damaging	1.00
R9660:Abca5	UTSW	11	110277422	missense	possibly damaging	0.80
R9788:Abca5	UTSW	11	110301427	missense	probably damaging	1.00
RF014:Abca5	UTSW	11	110279754	critical splice acceptor site	probably null
Z1177:Abca5	UTSW	11	110279328	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- TTAGACAGACAGACAGCCGG -3'
(R):5'- CCACTTGCAGACATGTGCTG -3'

Sequencing Primer
(F):5'- CAGACAGCCGGATGATAAGAATG -3'
(R):5'- CATGTGCTGTCATGTTGATGG -3'

Posted On

2021-11-19