Incidental Mutation 'R9028:Gaa'
ID 686891
Institutional Source Beutler Lab
Gene Symbol Gaa
Ensembl Gene ENSMUSG00000025579
Gene Name glucosidase, alpha, acid
Synonyms E430018M07Rik
MMRRC Submission 068857-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.731) question?
Stock # R9028 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 119158789-119176284 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 119161207 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 83 (D83E)
Ref Sequence ENSEMBL: ENSMUSP00000026666 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026666] [ENSMUST00000106258] [ENSMUST00000106259] [ENSMUST00000132706]
AlphaFold P70699
Predicted Effect probably benign
Transcript: ENSMUST00000026666
AA Change: D83E

PolyPhen 2 Score 0.155 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000026666
Gene: ENSMUSG00000025579
AA Change: D83E

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PD 80 134 1.08e-15 SMART
Pfam:Gal_mutarotas_2 254 320 3.7e-12 PFAM
Pfam:Glyco_hydro_31 340 825 8.8e-175 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106258
AA Change: D83E

PolyPhen 2 Score 0.155 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000101865
Gene: ENSMUSG00000025579
AA Change: D83E

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PD 80 134 1.08e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106259
AA Change: D83E

PolyPhen 2 Score 0.155 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000101866
Gene: ENSMUSG00000025579
AA Change: D83E

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PD 80 134 1.08e-15 SMART
Pfam:NtCtMGAM_N 147 253 3.5e-32 PFAM
Pfam:Gal_mutarotas_2 254 320 6.5e-12 PFAM
Pfam:Glyco_hydro_31 340 825 1.8e-153 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132706
SMART Domains Protein: ENSMUSP00000119702
Gene: ENSMUSG00000025579

DomainStartEndE-ValueType
Pfam:Glyco_hydro_31 46 269 2.9e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150562
SMART Domains Protein: ENSMUSP00000115128
Gene: ENSMUSG00000025579

DomainStartEndE-ValueType
Pfam:Glyco_hydro_31 1 96 4.3e-28 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: This gene encodes a lysosomal acid glucosidase that is involved in the degradation of glycogen. The encoded preproprotein undergoes proteolytic processing to generate a mature enzyme that cleaves alpha-1-4 and alpha-1-6 glycosidic bonds of glycogen, maltose and intermediate oligosaccharides within the lysosome. Mice lacking the encoded protein exhibit symptoms similar to human Pompe syndrome such as accumulation of glycogen in cardiac and skeletal muscle lysosomes resulting in reduced mobility and strength. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous inactivation of this gene leads to massive glycogen accumulation in multiple organs, cardiomyopathy, hypoactivity, severe motor disability, profound muscle weakness and wasting, and progressive kyphosis. The age of onset and clinical course ofthe disease appear to be strain-dependent. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 77,023,977 (GRCm39) V1066A probably damaging Het
Abca5 T A 11: 110,188,904 (GRCm39) H851L probably damaging Het
Actn2 T C 13: 12,315,864 (GRCm39) I218M possibly damaging Het
Afmid G A 11: 117,727,489 (GRCm39) E338K probably benign Het
Amer3 G A 1: 34,627,758 (GRCm39) V666I probably benign Het
Apol7b A G 15: 77,307,616 (GRCm39) V293A probably damaging Het
Bag6 T A 17: 35,363,130 (GRCm39) S657T probably benign Het
Btaf1 T C 19: 36,946,508 (GRCm39) L438P probably damaging Het
Cdc20 T C 4: 118,293,757 (GRCm39) E126G probably benign Het
Cep97 C T 16: 55,739,915 (GRCm39) W248* probably null Het
Cfap69 A T 5: 5,696,958 (GRCm39) S113T probably benign Het
Cgrrf1 C A 14: 47,091,200 (GRCm39) D241E probably benign Het
Cnksr1 T C 4: 133,960,608 (GRCm39) T280A possibly damaging Het
Cox4i1 T A 8: 121,398,022 (GRCm39) probably benign Het
Cpm T A 10: 117,519,414 (GRCm39) F441I probably benign Het
Cs A C 10: 128,188,952 (GRCm39) M154L Het
Dmrta1 T A 4: 89,579,914 (GRCm39) N291K probably damaging Het
Dnah7a T C 1: 53,560,297 (GRCm39) T2125A probably benign Het
Dock10 A T 1: 80,584,012 (GRCm39) probably benign Het
Dok7 A G 5: 35,236,819 (GRCm39) Y369C probably damaging Het
E130311K13Rik T C 3: 63,822,969 (GRCm39) Y225C probably damaging Het
Elapor1 G A 3: 108,370,819 (GRCm39) T687I probably benign Het
F7 T C 8: 13,076,087 (GRCm39) L10P possibly damaging Het
Faf1 C A 4: 109,748,105 (GRCm39) T470K possibly damaging Het
Fam83h A T 15: 75,875,738 (GRCm39) L533Q possibly damaging Het
Far1 T A 7: 113,146,629 (GRCm39) V129E probably damaging Het
Fgfr4 T C 13: 55,306,967 (GRCm39) Y219H probably damaging Het
Fryl A T 5: 73,255,609 (GRCm39) S807R probably benign Het
Grm2 A G 9: 106,528,384 (GRCm39) S167P possibly damaging Het
H1f11-ps T C 19: 47,159,129 (GRCm39) K149E unknown Het
Hibch T C 1: 52,892,868 (GRCm39) L26P possibly damaging Het
Hspa9 T C 18: 35,075,084 (GRCm39) E415G probably damaging Het
Ipo4 T C 14: 55,866,408 (GRCm39) Y757C probably damaging Het
Itk T A 11: 46,235,710 (GRCm39) probably benign Het
Kdm5a C T 6: 120,416,092 (GRCm39) P1671S probably benign Het
Kif13a G A 13: 46,951,841 (GRCm39) P811S probably damaging Het
Kif23 T C 9: 61,828,341 (GRCm39) E857G probably damaging Het
Kif2b A G 11: 91,468,011 (GRCm39) S91P probably benign Het
Letm1 G T 5: 33,909,847 (GRCm39) Q396K probably damaging Het
Map2k6 T A 11: 110,388,799 (GRCm39) M247K Het
Mga A G 2: 119,778,070 (GRCm39) I1872V probably benign Het
Mmp15 A T 8: 96,096,316 (GRCm39) N369I probably benign Het
Myo3a T A 2: 22,490,099 (GRCm39) S1487T possibly damaging Het
Ncam1 T C 9: 49,418,736 (GRCm39) T855A Het
Ncoa2 A G 1: 13,223,079 (GRCm39) V1182A probably benign Het
Nhlrc3 A T 3: 53,360,992 (GRCm39) C254* probably null Het
Nlrp1a C T 11: 71,013,819 (GRCm39) R477H probably benign Het
Nox3 T A 17: 3,716,185 (GRCm39) T407S possibly damaging Het
Or1x6 C T 11: 50,939,660 (GRCm39) T242M probably damaging Het
Or3a1d T C 11: 74,237,747 (GRCm39) Y101C probably damaging Het
Or4c15b T A 2: 89,112,676 (GRCm39) D267V probably damaging Het
Pfkp T A 13: 6,655,725 (GRCm39) I303F probably damaging Het
Pgc T C 17: 48,043,983 (GRCm39) Y292H possibly damaging Het
Phtf2 A G 5: 20,999,373 (GRCm39) Y257H probably benign Het
Pkdrej T C 15: 85,701,098 (GRCm39) N1613D probably damaging Het
Prb1b C T 6: 132,289,618 (GRCm39) E69K unknown Het
Rapgef2 A G 3: 78,981,651 (GRCm39) S1115P probably damaging Het
Rbpj A G 5: 53,807,032 (GRCm39) E260G possibly damaging Het
Rrm1 T A 7: 102,109,605 (GRCm39) N476K probably damaging Het
Slc9a2 T A 1: 40,765,612 (GRCm39) I334N probably damaging Het
Slk T G 19: 47,608,512 (GRCm39) N488K probably benign Het
Smarca5 T C 8: 81,440,642 (GRCm39) I607M probably damaging Het
Sspo G A 6: 48,473,087 (GRCm39) V162M probably benign Het
Svep1 T G 4: 58,145,199 (GRCm39) Q422P possibly damaging Het
Tcn2 C T 11: 3,872,111 (GRCm39) V339I probably damaging Het
Tnfrsf19 T C 14: 61,242,650 (GRCm39) H78R probably benign Het
Trav14-3 C A 14: 54,000,887 (GRCm39) Q33K unknown Het
Ubtd2 T C 11: 32,449,432 (GRCm39) I93T possibly damaging Het
Uhrf2 G A 19: 30,066,744 (GRCm39) probably null Het
Vmn1r224 T G 17: 20,640,112 (GRCm39) S230A possibly damaging Het
Wee2 A T 6: 40,421,189 (GRCm39) H93L probably benign Het
Zdhhc17 T C 10: 110,796,934 (GRCm39) E279G probably damaging Het
Zfp623 T A 15: 75,819,349 (GRCm39) F102I probably damaging Het
Zfpm2 A C 15: 40,966,758 (GRCm39) E1081A possibly damaging Het
Zscan18 A T 7: 12,506,116 (GRCm39) probably benign Het
Other mutations in Gaa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Gaa APN 11 119,165,786 (GRCm39) missense probably benign
IGL00780:Gaa APN 11 119,165,117 (GRCm39) splice site probably null
IGL00975:Gaa APN 11 119,165,509 (GRCm39) missense possibly damaging 0.93
IGL01354:Gaa APN 11 119,161,394 (GRCm39) missense probably benign 0.18
IGL01572:Gaa APN 11 119,175,003 (GRCm39) missense probably benign
IGL01634:Gaa APN 11 119,164,902 (GRCm39) missense possibly damaging 0.79
IGL01724:Gaa APN 11 119,165,947 (GRCm39) missense possibly damaging 0.65
IGL01889:Gaa APN 11 119,169,123 (GRCm39) missense probably benign 0.03
IGL02052:Gaa APN 11 119,175,021 (GRCm39) missense possibly damaging 0.76
IGL02173:Gaa APN 11 119,165,739 (GRCm39) missense probably damaging 1.00
IGL02261:Gaa APN 11 119,172,091 (GRCm39) makesense probably null
IGL02337:Gaa APN 11 119,168,429 (GRCm39) missense probably damaging 1.00
IGL02625:Gaa APN 11 119,165,559 (GRCm39) missense probably damaging 1.00
IGL02818:Gaa APN 11 119,167,674 (GRCm39) missense probably damaging 0.97
R0135:Gaa UTSW 11 119,169,716 (GRCm39) missense probably benign 0.00
R0280:Gaa UTSW 11 119,175,373 (GRCm39) missense probably damaging 1.00
R0479:Gaa UTSW 11 119,172,062 (GRCm39) missense possibly damaging 0.95
R1130:Gaa UTSW 11 119,165,509 (GRCm39) missense probably damaging 0.97
R1132:Gaa UTSW 11 119,175,885 (GRCm39) missense probably damaging 0.99
R1146:Gaa UTSW 11 119,165,730 (GRCm39) missense probably damaging 1.00
R1146:Gaa UTSW 11 119,165,730 (GRCm39) missense probably damaging 1.00
R1179:Gaa UTSW 11 119,171,954 (GRCm39) missense probably damaging 0.98
R1464:Gaa UTSW 11 119,163,810 (GRCm39) missense probably benign 0.02
R1464:Gaa UTSW 11 119,163,810 (GRCm39) missense probably benign 0.02
R1475:Gaa UTSW 11 119,165,142 (GRCm39) splice site probably null
R1711:Gaa UTSW 11 119,171,286 (GRCm39) missense probably damaging 1.00
R1817:Gaa UTSW 11 119,175,324 (GRCm39) nonsense probably null
R1828:Gaa UTSW 11 119,174,098 (GRCm39) missense probably damaging 0.99
R2013:Gaa UTSW 11 119,175,409 (GRCm39) splice site probably null
R2126:Gaa UTSW 11 119,161,108 (GRCm39) nonsense probably null
R2179:Gaa UTSW 11 119,165,884 (GRCm39) critical splice acceptor site probably null
R2496:Gaa UTSW 11 119,174,531 (GRCm39) missense possibly damaging 0.53
R2936:Gaa UTSW 11 119,174,550 (GRCm39) missense probably benign 0.02
R4321:Gaa UTSW 11 119,160,963 (GRCm39) missense probably benign 0.20
R4603:Gaa UTSW 11 119,169,784 (GRCm39) missense probably damaging 1.00
R4849:Gaa UTSW 11 119,163,813 (GRCm39) missense possibly damaging 0.95
R5225:Gaa UTSW 11 119,167,669 (GRCm39) missense probably damaging 1.00
R5643:Gaa UTSW 11 119,171,361 (GRCm39) missense possibly damaging 0.96
R5644:Gaa UTSW 11 119,171,361 (GRCm39) missense possibly damaging 0.96
R6074:Gaa UTSW 11 119,175,012 (GRCm39) missense probably benign 0.07
R6154:Gaa UTSW 11 119,169,178 (GRCm39) missense probably damaging 1.00
R6208:Gaa UTSW 11 119,171,997 (GRCm39) missense probably benign 0.01
R6209:Gaa UTSW 11 119,171,997 (GRCm39) missense probably benign 0.01
R6258:Gaa UTSW 11 119,171,997 (GRCm39) missense probably benign 0.01
R6259:Gaa UTSW 11 119,171,997 (GRCm39) missense probably benign 0.01
R6260:Gaa UTSW 11 119,171,997 (GRCm39) missense probably benign 0.01
R7173:Gaa UTSW 11 119,169,817 (GRCm39) missense probably damaging 1.00
R7211:Gaa UTSW 11 119,175,030 (GRCm39) missense possibly damaging 0.80
R7379:Gaa UTSW 11 119,174,525 (GRCm39) missense probably benign
R8011:Gaa UTSW 11 119,163,762 (GRCm39) missense probably benign 0.00
R8135:Gaa UTSW 11 119,169,210 (GRCm39) critical splice donor site probably null
R8192:Gaa UTSW 11 119,161,235 (GRCm39) missense possibly damaging 0.92
R8807:Gaa UTSW 11 119,168,393 (GRCm39) missense probably benign 0.02
R9453:Gaa UTSW 11 119,165,959 (GRCm39) missense probably benign 0.21
R9453:Gaa UTSW 11 119,165,958 (GRCm39) missense probably damaging 1.00
X0064:Gaa UTSW 11 119,164,841 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTTCGAACTCCGTGGTTG -3'
(R):5'- TCAGGTTCTCTAGACGGTAGC -3'

Sequencing Primer
(F):5'- TGACTACAGCGGTCATCCTG -3'
(R):5'- CTCTAGACGGTAGCTTGGGTAG -3'
Posted On 2021-11-19