Incidental Mutation 'R9028:Tnfrsf19'
ID 686899
Institutional Source Beutler Lab
Gene Symbol Tnfrsf19
Ensembl Gene ENSMUSG00000060548
Gene Name tumor necrosis factor receptor superfamily, member 19
Synonyms TRADE, Troy, TAJ-ALPHA, TAJ
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9028 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 60963875-61046490 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 61005201 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 78 (H78R)
Ref Sequence ENSEMBL: ENSMUSP00000106865 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111234] [ENSMUST00000111236] [ENSMUST00000224371] [ENSMUST00000225730]
AlphaFold Q9JLL3
Predicted Effect probably benign
Transcript: ENSMUST00000111234
AA Change: H78R

PolyPhen 2 Score 0.261 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000106865
Gene: ENSMUSG00000060548
AA Change: H78R

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
TNFR 34 72 1.75e0 SMART
TNFR 75 114 3.32e-1 SMART
transmembrane domain 169 191 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111236
AA Change: H78R

PolyPhen 2 Score 0.261 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000106867
Gene: ENSMUSG00000060548
AA Change: H78R

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
TNFR 34 72 1.75e0 SMART
TNFR 75 114 3.32e-1 SMART
transmembrane domain 169 191 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224371
AA Change: H78R

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Predicted Effect probably benign
Transcript: ENSMUST00000225730
AA Change: H78R

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor is highly expressed during embryonic development. It has been shown to interact with TRAF family members, and to activate JNK signaling pathway when overexpressed in cells. This receptor is capable of inducing apoptosis by a caspase-independent mechanism, and it is thought to play an essential role in embryonic development. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice exhibit no obvious physical abnormalities or alterations in behavior, locomotion, or fecundity, however neurons are more resistant to the suppressive action of myelin inhibitors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik G A 3: 108,463,503 T687I probably benign Het
Aasdh A G 5: 76,876,130 V1066A probably damaging Het
Abca5 T A 11: 110,298,078 H851L probably damaging Het
Actn2 T C 13: 12,300,978 I218M possibly damaging Het
Afmid G A 11: 117,836,663 E338K probably benign Het
Amer3 G A 1: 34,588,677 V666I probably benign Het
Apol7b A G 15: 77,423,416 V293A probably damaging Het
Bag6 T A 17: 35,144,154 S657T probably benign Het
Btaf1 T C 19: 36,969,108 L438P probably damaging Het
Cdc20 T C 4: 118,436,560 E126G probably benign Het
Cep97 C T 16: 55,919,552 W248* probably null Het
Cfap69 A T 5: 5,646,958 S113T probably benign Het
Cgrrf1 C A 14: 46,853,743 D241E probably benign Het
Cnksr1 T C 4: 134,233,297 T280A possibly damaging Het
Cox4i1 T A 8: 120,671,283 probably benign Het
Cpm T A 10: 117,683,509 F441I probably benign Het
Cs A C 10: 128,353,083 M154L Het
Dmrta1 T A 4: 89,691,677 N291K probably damaging Het
Dnah7a T C 1: 53,521,138 T2125A probably benign Het
Dock10 A T 1: 80,606,295 probably benign Het
Dok7 A G 5: 35,079,475 Y369C probably damaging Het
E130311K13Rik T C 3: 63,915,548 Y225C probably damaging Het
F7 T C 8: 13,026,087 L10P possibly damaging Het
Faf1 C A 4: 109,890,908 T470K possibly damaging Het
Fam83h A T 15: 76,003,889 L533Q possibly damaging Het
Far1 T A 7: 113,547,422 V129E probably damaging Het
Fgfr4 T C 13: 55,159,154 Y219H probably damaging Het
Fryl A T 5: 73,098,266 S807R probably benign Het
Gaa T A 11: 119,270,381 D83E probably benign Het
Gm6970 T C 19: 47,170,690 K149E unknown Het
Grm2 A G 9: 106,651,185 S167P possibly damaging Het
Hibch T C 1: 52,853,709 L26P possibly damaging Het
Hspa9 T C 18: 34,942,031 E415G probably damaging Het
Ipo4 T C 14: 55,628,951 Y757C probably damaging Het
Itk T A 11: 46,344,883 probably benign Het
Kdm5a C T 6: 120,439,131 P1671S probably benign Het
Kif13a G A 13: 46,798,365 P811S probably damaging Het
Kif23 T C 9: 61,921,059 E857G probably damaging Het
Kif2b A G 11: 91,577,185 S91P probably benign Het
Letm1 G T 5: 33,752,503 Q396K probably damaging Het
Map2k6 T A 11: 110,497,973 M247K Het
Mga A G 2: 119,947,589 I1872V probably benign Het
Mmp15 A T 8: 95,369,688 N369I probably benign Het
Myo3a T A 2: 22,600,087 S1487T possibly damaging Het
Ncam1 T C 9: 49,507,436 T855A Het
Ncoa2 A G 1: 13,152,855 V1182A probably benign Het
Nhlrc3 A T 3: 53,453,571 C254* probably null Het
Nlrp1a C T 11: 71,122,993 R477H probably benign Het
Nox3 T A 17: 3,665,910 T407S possibly damaging Het
Olfr1229 T A 2: 89,282,332 D267V probably damaging Het
Olfr1375 C T 11: 51,048,833 T242M probably damaging Het
Olfr411 T C 11: 74,346,921 Y101C probably damaging Het
Pfkp T A 13: 6,605,689 I303F probably damaging Het
Pgc T C 17: 47,733,058 Y292H possibly damaging Het
Phtf2 A G 5: 20,794,375 Y257H probably benign Het
Pkdrej T C 15: 85,816,897 N1613D probably damaging Het
Prpmp5 C T 6: 132,312,655 E69K unknown Het
Rapgef2 A G 3: 79,074,344 S1115P probably damaging Het
Rbpj A G 5: 53,649,690 E260G possibly damaging Het
Rrm1 T A 7: 102,460,398 N476K probably damaging Het
Slc9a2 T A 1: 40,726,452 I334N probably damaging Het
Slk T G 19: 47,620,073 N488K probably benign Het
Smarca5 T C 8: 80,714,013 I607M probably damaging Het
Sspo G A 6: 48,496,153 V162M probably benign Het
Svep1 T G 4: 58,145,199 Q422P possibly damaging Het
Tcn2 C T 11: 3,922,111 V339I probably damaging Het
Trav14-3 C A 14: 53,763,430 Q33K unknown Het
Ubtd2 T C 11: 32,499,432 I93T possibly damaging Het
Uhrf2 G A 19: 30,089,344 probably null Het
Vmn1r224 T G 17: 20,419,850 S230A possibly damaging Het
Wee2 A T 6: 40,444,255 H93L probably benign Het
Zdhhc17 T C 10: 110,961,073 E279G probably damaging Het
Zfp623 T A 15: 75,947,500 F102I probably damaging Het
Zfpm2 A C 15: 41,103,362 E1081A possibly damaging Het
Zscan18 A T 7: 12,772,189 probably benign Het
Other mutations in Tnfrsf19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Tnfrsf19 APN 14 61024182 missense possibly damaging 0.53
IGL01564:Tnfrsf19 APN 14 60974609 missense possibly damaging 0.85
IGL01878:Tnfrsf19 APN 14 60996644 missense probably damaging 0.98
IGL02220:Tnfrsf19 APN 14 60973492 unclassified probably benign
IGL02378:Tnfrsf19 APN 14 60971002 missense probably benign 0.00
IGL02546:Tnfrsf19 APN 14 60973538 missense possibly damaging 0.86
IGL02583:Tnfrsf19 APN 14 61024210 missense probably damaging 0.98
IGL03037:Tnfrsf19 APN 14 61024272 missense possibly damaging 0.83
IGL03221:Tnfrsf19 APN 14 61024778 missense probably benign 0.06
R0241:Tnfrsf19 UTSW 14 60973592 missense possibly damaging 0.93
R0373:Tnfrsf19 UTSW 14 60972036 missense possibly damaging 0.47
R1521:Tnfrsf19 UTSW 14 61005106 missense probably damaging 0.99
R3038:Tnfrsf19 UTSW 14 60972063 missense probably benign
R4346:Tnfrsf19 UTSW 14 60971980 critical splice donor site probably null
R4997:Tnfrsf19 UTSW 14 60971209 missense probably benign
R5756:Tnfrsf19 UTSW 14 61024775 missense probably benign
R5869:Tnfrsf19 UTSW 14 60971178 missense possibly damaging 0.70
R6110:Tnfrsf19 UTSW 14 60971139 missense probably benign 0.08
R7047:Tnfrsf19 UTSW 14 61005218 nonsense probably null
R7266:Tnfrsf19 UTSW 14 60974698 missense possibly damaging 0.91
R7491:Tnfrsf19 UTSW 14 61005205 missense possibly damaging 0.75
R7729:Tnfrsf19 UTSW 14 60974734 missense possibly damaging 0.70
R7936:Tnfrsf19 UTSW 14 60970933 missense probably benign 0.22
R8358:Tnfrsf19 UTSW 14 60971185 missense probably benign 0.25
R8535:Tnfrsf19 UTSW 14 60970968 missense probably benign 0.25
R8693:Tnfrsf19 UTSW 14 60971002 missense probably benign
R9468:Tnfrsf19 UTSW 14 61024174 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AAGTTCTTACCACGGTGCTTTC -3'
(R):5'- AACTTGCTGAAAGGGCTGC -3'

Sequencing Primer
(F):5'- ACCACGGTGCTTTCAAGTTTAGAG -3'
(R):5'- CCTTTGTGTCCAGGAAGGCAG -3'
Posted On 2021-11-19