Incidental Mutation 'R9028:Pgc'
ID 686909
Institutional Source Beutler Lab
Gene Symbol Pgc
Ensembl Gene ENSMUSG00000023987
Gene Name progastricsin (pepsinogen C)
Synonyms Upg-1, 2210410L06Rik, Upg1
MMRRC Submission 068857-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.057) question?
Stock # R9028 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 48037767-48045403 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 48043983 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 292 (Y292H)
Ref Sequence ENSEMBL: ENSMUSP00000024782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024782] [ENSMUST00000086932] [ENSMUST00000113288] [ENSMUST00000126258] [ENSMUST00000144955]
AlphaFold Q9D7R7
Predicted Effect possibly damaging
Transcript: ENSMUST00000024782
AA Change: Y292H

PolyPhen 2 Score 0.510 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000024782
Gene: ENSMUSG00000023987
AA Change: Y292H

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:A1_Propeptide 18 46 2.1e-17 PFAM
Pfam:Asp 75 391 6.3e-118 PFAM
Pfam:TAXi_N 76 232 7.2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000086932
SMART Domains Protein: ENSMUSP00000084151
Gene: ENSMUSG00000023990

DomainStartEndE-ValueType
low complexity region 7 43 N/A INTRINSIC
low complexity region 108 122 N/A INTRINSIC
HLH 240 293 1.44e-15 SMART
Pfam:DUF3371 320 473 7e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113288
SMART Domains Protein: ENSMUSP00000108913
Gene: ENSMUSG00000023990

DomainStartEndE-ValueType
low complexity region 7 43 N/A INTRINSIC
low complexity region 108 122 N/A INTRINSIC
HLH 240 293 1.44e-15 SMART
Pfam:DUF3371 320 473 7e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126258
Predicted Effect probably benign
Transcript: ENSMUST00000144955
SMART Domains Protein: ENSMUSP00000123459
Gene: ENSMUSG00000023987

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:A1_Propeptide 18 46 1.5e-18 PFAM
Pfam:Asp 63 143 1.4e-19 PFAM
Meta Mutation Damage Score 0.2927 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an aspartic proteinase that belongs to the peptidase family A1. The encoded protein is a digestive enzyme that is produced in the stomach and constitutes a major component of the gastric mucosa. This protein is also secreted into the serum. This protein is synthesized as an inactive zymogen that includes a highly basic prosegment. This enzyme is converted into its active mature form at low pH by sequential cleavage of the prosegment that is carried out by the enzyme itself. Polymorphisms in this gene are associated with susceptibility to gastric cancers. Serum levels of this enzyme are used as a biomarker for certain gastric diseases including Helicobacter pylori related gastritis. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 1. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 77,023,977 (GRCm39) V1066A probably damaging Het
Abca5 T A 11: 110,188,904 (GRCm39) H851L probably damaging Het
Actn2 T C 13: 12,315,864 (GRCm39) I218M possibly damaging Het
Afmid G A 11: 117,727,489 (GRCm39) E338K probably benign Het
Amer3 G A 1: 34,627,758 (GRCm39) V666I probably benign Het
Apol7b A G 15: 77,307,616 (GRCm39) V293A probably damaging Het
Bag6 T A 17: 35,363,130 (GRCm39) S657T probably benign Het
Btaf1 T C 19: 36,946,508 (GRCm39) L438P probably damaging Het
Cdc20 T C 4: 118,293,757 (GRCm39) E126G probably benign Het
Cep97 C T 16: 55,739,915 (GRCm39) W248* probably null Het
Cfap69 A T 5: 5,696,958 (GRCm39) S113T probably benign Het
Cgrrf1 C A 14: 47,091,200 (GRCm39) D241E probably benign Het
Cnksr1 T C 4: 133,960,608 (GRCm39) T280A possibly damaging Het
Cox4i1 T A 8: 121,398,022 (GRCm39) probably benign Het
Cpm T A 10: 117,519,414 (GRCm39) F441I probably benign Het
Cs A C 10: 128,188,952 (GRCm39) M154L Het
Dmrta1 T A 4: 89,579,914 (GRCm39) N291K probably damaging Het
Dnah7a T C 1: 53,560,297 (GRCm39) T2125A probably benign Het
Dock10 A T 1: 80,584,012 (GRCm39) probably benign Het
Dok7 A G 5: 35,236,819 (GRCm39) Y369C probably damaging Het
E130311K13Rik T C 3: 63,822,969 (GRCm39) Y225C probably damaging Het
Elapor1 G A 3: 108,370,819 (GRCm39) T687I probably benign Het
F7 T C 8: 13,076,087 (GRCm39) L10P possibly damaging Het
Faf1 C A 4: 109,748,105 (GRCm39) T470K possibly damaging Het
Fam83h A T 15: 75,875,738 (GRCm39) L533Q possibly damaging Het
Far1 T A 7: 113,146,629 (GRCm39) V129E probably damaging Het
Fgfr4 T C 13: 55,306,967 (GRCm39) Y219H probably damaging Het
Fryl A T 5: 73,255,609 (GRCm39) S807R probably benign Het
Gaa T A 11: 119,161,207 (GRCm39) D83E probably benign Het
Grm2 A G 9: 106,528,384 (GRCm39) S167P possibly damaging Het
H1f11-ps T C 19: 47,159,129 (GRCm39) K149E unknown Het
Hibch T C 1: 52,892,868 (GRCm39) L26P possibly damaging Het
Hspa9 T C 18: 35,075,084 (GRCm39) E415G probably damaging Het
Ipo4 T C 14: 55,866,408 (GRCm39) Y757C probably damaging Het
Itk T A 11: 46,235,710 (GRCm39) probably benign Het
Kdm5a C T 6: 120,416,092 (GRCm39) P1671S probably benign Het
Kif13a G A 13: 46,951,841 (GRCm39) P811S probably damaging Het
Kif23 T C 9: 61,828,341 (GRCm39) E857G probably damaging Het
Kif2b A G 11: 91,468,011 (GRCm39) S91P probably benign Het
Letm1 G T 5: 33,909,847 (GRCm39) Q396K probably damaging Het
Map2k6 T A 11: 110,388,799 (GRCm39) M247K Het
Mga A G 2: 119,778,070 (GRCm39) I1872V probably benign Het
Mmp15 A T 8: 96,096,316 (GRCm39) N369I probably benign Het
Myo3a T A 2: 22,490,099 (GRCm39) S1487T possibly damaging Het
Ncam1 T C 9: 49,418,736 (GRCm39) T855A Het
Ncoa2 A G 1: 13,223,079 (GRCm39) V1182A probably benign Het
Nhlrc3 A T 3: 53,360,992 (GRCm39) C254* probably null Het
Nlrp1a C T 11: 71,013,819 (GRCm39) R477H probably benign Het
Nox3 T A 17: 3,716,185 (GRCm39) T407S possibly damaging Het
Or1x6 C T 11: 50,939,660 (GRCm39) T242M probably damaging Het
Or3a1d T C 11: 74,237,747 (GRCm39) Y101C probably damaging Het
Or4c15b T A 2: 89,112,676 (GRCm39) D267V probably damaging Het
Pfkp T A 13: 6,655,725 (GRCm39) I303F probably damaging Het
Phtf2 A G 5: 20,999,373 (GRCm39) Y257H probably benign Het
Pkdrej T C 15: 85,701,098 (GRCm39) N1613D probably damaging Het
Prb1b C T 6: 132,289,618 (GRCm39) E69K unknown Het
Rapgef2 A G 3: 78,981,651 (GRCm39) S1115P probably damaging Het
Rbpj A G 5: 53,807,032 (GRCm39) E260G possibly damaging Het
Rrm1 T A 7: 102,109,605 (GRCm39) N476K probably damaging Het
Slc9a2 T A 1: 40,765,612 (GRCm39) I334N probably damaging Het
Slk T G 19: 47,608,512 (GRCm39) N488K probably benign Het
Smarca5 T C 8: 81,440,642 (GRCm39) I607M probably damaging Het
Sspo G A 6: 48,473,087 (GRCm39) V162M probably benign Het
Svep1 T G 4: 58,145,199 (GRCm39) Q422P possibly damaging Het
Tcn2 C T 11: 3,872,111 (GRCm39) V339I probably damaging Het
Tnfrsf19 T C 14: 61,242,650 (GRCm39) H78R probably benign Het
Trav14-3 C A 14: 54,000,887 (GRCm39) Q33K unknown Het
Ubtd2 T C 11: 32,449,432 (GRCm39) I93T possibly damaging Het
Uhrf2 G A 19: 30,066,744 (GRCm39) probably null Het
Vmn1r224 T G 17: 20,640,112 (GRCm39) S230A possibly damaging Het
Wee2 A T 6: 40,421,189 (GRCm39) H93L probably benign Het
Zdhhc17 T C 10: 110,796,934 (GRCm39) E279G probably damaging Het
Zfp623 T A 15: 75,819,349 (GRCm39) F102I probably damaging Het
Zfpm2 A C 15: 40,966,758 (GRCm39) E1081A possibly damaging Het
Zscan18 A T 7: 12,506,116 (GRCm39) probably benign Het
Other mutations in Pgc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Pgc APN 17 48,041,591 (GRCm39) missense probably benign 0.09
IGL01410:Pgc APN 17 48,045,165 (GRCm39) missense probably damaging 0.98
IGL01647:Pgc APN 17 48,043,329 (GRCm39) missense probably damaging 1.00
IGL02141:Pgc APN 17 48,037,856 (GRCm39) missense probably damaging 1.00
IGL02719:Pgc APN 17 48,039,792 (GRCm39) missense probably damaging 0.98
PIT4469001:Pgc UTSW 17 48,039,680 (GRCm39) nonsense probably null
R0736:Pgc UTSW 17 48,039,705 (GRCm39) missense probably damaging 1.00
R1118:Pgc UTSW 17 48,039,828 (GRCm39) critical splice donor site probably null
R1669:Pgc UTSW 17 48,044,715 (GRCm39) missense probably damaging 1.00
R2162:Pgc UTSW 17 48,040,236 (GRCm39) missense probably null 0.96
R3831:Pgc UTSW 17 48,040,236 (GRCm39) missense probably null 0.96
R3833:Pgc UTSW 17 48,040,236 (GRCm39) missense probably null 0.96
R4454:Pgc UTSW 17 48,043,335 (GRCm39) missense probably benign 0.00
R4908:Pgc UTSW 17 48,039,819 (GRCm39) missense probably damaging 0.96
R5544:Pgc UTSW 17 48,043,429 (GRCm39) missense probably benign 0.00
R6829:Pgc UTSW 17 48,043,706 (GRCm39) splice site probably null
R7042:Pgc UTSW 17 48,044,745 (GRCm39) missense probably benign 0.00
R7508:Pgc UTSW 17 48,045,111 (GRCm39) missense probably benign 0.00
R8022:Pgc UTSW 17 48,039,701 (GRCm39) missense probably benign 0.00
R9074:Pgc UTSW 17 48,043,351 (GRCm39) missense probably damaging 0.98
Z1176:Pgc UTSW 17 48,039,793 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAACAACGTGGCCTCTGTATG -3'
(R):5'- CTTTGCTATACTACCAGGGCCAC -3'

Sequencing Primer
(F):5'- TCTGTATGCAGCCACCCGTG -3'
(R):5'- ACTCCCACCAGTTCCTTCAATAG -3'
Posted On 2021-11-19