Incidental Mutation 'R9029:Tnrc6b'
ID 686959
Institutional Source Beutler Lab
Gene Symbol Tnrc6b
Ensembl Gene ENSMUSG00000047888
Gene Name trinucleotide repeat containing 6b
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.193) question?
Stock # R9029 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 80711313-80941085 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 80878978 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 227 (V227A)
Ref Sequence ENSEMBL: ENSMUSP00000064336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067689]
AlphaFold Q8BKI2
Predicted Effect possibly damaging
Transcript: ENSMUST00000067689
AA Change: V227A

PolyPhen 2 Score 0.832 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000064336
Gene: ENSMUSG00000047888
AA Change: V227A

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
coiled coil region 33 72 N/A INTRINSIC
low complexity region 88 106 N/A INTRINSIC
low complexity region 155 174 N/A INTRINSIC
low complexity region 207 220 N/A INTRINSIC
low complexity region 242 260 N/A INTRINSIC
low complexity region 331 346 N/A INTRINSIC
low complexity region 363 380 N/A INTRINSIC
low complexity region 416 425 N/A INTRINSIC
low complexity region 475 487 N/A INTRINSIC
internal_repeat_1 488 667 6.43e-5 PROSPERO
low complexity region 858 888 N/A INTRINSIC
Pfam:Ago_hook 955 1095 1.2e-28 PFAM
coiled coil region 1258 1307 N/A INTRINSIC
Pfam:TNRC6-PABC_bdg 1339 1623 2.8e-112 PFAM
Pfam:RRM_5 1641 1695 2e-7 PFAM
low complexity region 1705 1721 N/A INTRINSIC
low complexity region 1748 1769 N/A INTRINSIC
low complexity region 1792 1809 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000228124
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (56/56)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit neonatal and postnatal lethality with decreased body weight and infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd35 A T 3: 96,684,144 K582M probably benign Het
Catsper3 T G 13: 55,806,334 V305G probably damaging Het
Chd9 G A 8: 90,956,570 R546Q unknown Het
Cnot6l G A 5: 96,098,277 T171I probably benign Het
Cpne3 A G 4: 19,535,292 Y247H possibly damaging Het
Cramp1l C G 17: 25,013,910 A39P probably damaging Het
Cyp26b1 A T 6: 84,577,053 V194E probably benign Het
Dchs1 A G 7: 105,753,712 S3208P probably benign Het
Dhrs3 A G 4: 144,927,185 Y292C probably damaging Het
Eif3l T C 15: 79,084,212 V227A probably damaging Het
Eif4enif1 T C 11: 3,224,716 V290A probably damaging Het
Epb41l4a A C 18: 33,878,989 Y159* probably null Het
Gm5460 T A 14: 34,017,369 S103T Het
Gsto1 A T 19: 47,864,398 Y224F probably benign Het
Hpd G A 5: 123,175,910 T271M probably damaging Het
Ift74 T C 4: 94,618,034 I18T probably benign Het
Kif12 A G 4: 63,169,467 C260R probably damaging Het
Klk15 C T 7: 43,938,366 H73Y possibly damaging Het
Luc7l3 A G 11: 94,297,850 V201A unknown Het
Mcrip2 T C 17: 25,864,015 E146G probably damaging Het
Mctp1 T A 13: 76,688,622 Y323N probably benign Het
Micu2 T A 14: 57,918,906 I370F probably damaging Het
Mug2 T A 6: 122,084,369 V1416E probably damaging Het
Mup3 T C 4: 62,085,303 N110D probably damaging Het
Nav3 C T 10: 109,863,752 D294N possibly damaging Het
Nphs2 G A 1: 156,313,022 A110T probably benign Het
Olfr1086 A G 2: 86,676,487 M282T probably damaging Het
Olfr403 T C 11: 74,195,737 I78T possibly damaging Het
Olfr811 G T 10: 129,802,057 P156Q probably damaging Het
Otof C T 5: 30,370,075 probably null Het
Pgrmc2 G T 3: 41,082,670 R109S probably benign Het
Plb1 G A 5: 32,281,735 V214I probably damaging Het
Ppp2r5d C T 17: 46,687,980 S52N probably benign Het
Rrp12 C A 19: 41,871,279 E1082* probably null Het
Skint3 A G 4: 112,253,954 E92G probably damaging Het
Slc12a1 C G 2: 125,154,084 N52K probably benign Het
Smu1 A G 4: 40,738,361 Y458H probably damaging Het
Spsb3 C T 17: 24,891,532 P317S unknown Het
Ssc5d A T 7: 4,927,920 Q167L probably damaging Het
Ssh2 T C 11: 77,437,628 V340A probably damaging Het
Stag3 G A 5: 138,298,034 R453H probably damaging Het
Svil T A 18: 5,056,239 F371I probably benign Het
Tas2r140 A C 6: 133,055,218 S192R possibly damaging Het
Tdrp T C 8: 13,953,840 I166V possibly damaging Het
Tgm3 C A 2: 130,029,760 Q269K probably benign Het
Thsd7b G A 1: 130,159,689 C1181Y probably damaging Het
Tinag A T 9: 77,027,014 probably benign Het
Tox3 A C 8: 90,270,236 L133R possibly damaging Het
Tshz1 A T 18: 84,013,514 I923N probably damaging Het
Vps13c T A 9: 67,948,147 V2498D probably damaging Het
Vps41 T A 13: 18,810,553 probably null Het
Xylt2 T C 11: 94,664,636 D850G probably damaging Het
Zfp229 T A 17: 21,745,340 S184T possibly damaging Het
Zfp518a G A 19: 40,912,781 V385I probably benign Het
Zfp595 C A 13: 67,320,925 M12I probably benign Het
Zfp750 T C 11: 121,512,323 Q533R probably benign Het
Other mutations in Tnrc6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01312:Tnrc6b APN 15 80923578 missense probably damaging 1.00
IGL01402:Tnrc6b APN 15 80880544 missense possibly damaging 0.71
IGL01505:Tnrc6b APN 15 80879963 missense probably benign 0.00
IGL01516:Tnrc6b APN 15 80902622 missense possibly damaging 0.93
IGL01584:Tnrc6b APN 15 80879682 missense probably benign 0.01
IGL01681:Tnrc6b APN 15 80879311 splice site probably null
IGL01909:Tnrc6b APN 15 80901983 missense possibly damaging 0.88
IGL01943:Tnrc6b APN 15 80927695 nonsense probably null
IGL02253:Tnrc6b APN 15 80876541 missense probably damaging 0.99
IGL02260:Tnrc6b APN 15 80880171 missense probably damaging 0.99
IGL02437:Tnrc6b APN 15 80880457 missense probably damaging 1.00
IGL02541:Tnrc6b APN 15 80879831 missense probably benign 0.00
IGL02542:Tnrc6b APN 15 80902352 missense possibly damaging 0.83
grosser UTSW 15 80929285 missense probably damaging 1.00
heiliger UTSW 15 80927741 critical splice donor site probably null
PIT1430001:Tnrc6b UTSW 15 80929186 missense probably damaging 0.99
R0092:Tnrc6b UTSW 15 80918528 missense probably damaging 1.00
R0165:Tnrc6b UTSW 15 80858670 splice site probably null
R0238:Tnrc6b UTSW 15 80887864 missense probably damaging 1.00
R0238:Tnrc6b UTSW 15 80887864 missense probably damaging 1.00
R0257:Tnrc6b UTSW 15 80894355 missense possibly damaging 0.80
R0418:Tnrc6b UTSW 15 80913323 missense probably benign 0.27
R0432:Tnrc6b UTSW 15 80923446 splice site probably benign
R0487:Tnrc6b UTSW 15 80880675 missense probably benign 0.01
R0498:Tnrc6b UTSW 15 80858719 missense probably damaging 0.98
R0528:Tnrc6b UTSW 15 80879403 missense probably benign 0.00
R0533:Tnrc6b UTSW 15 80876653 missense probably benign 0.00
R0571:Tnrc6b UTSW 15 80913338 missense probably damaging 1.00
R0650:Tnrc6b UTSW 15 80784758 missense probably benign 0.33
R0659:Tnrc6b UTSW 15 80923446 splice site probably benign
R0884:Tnrc6b UTSW 15 80902555 small deletion probably benign
R1131:Tnrc6b UTSW 15 80894453 missense possibly damaging 0.45
R1188:Tnrc6b UTSW 15 80879229 missense probably benign
R1479:Tnrc6b UTSW 15 80887032 splice site probably null
R1564:Tnrc6b UTSW 15 80880168 missense possibly damaging 0.95
R1645:Tnrc6b UTSW 15 80882958 missense probably damaging 0.99
R1924:Tnrc6b UTSW 15 80884206 critical splice acceptor site probably null
R1926:Tnrc6b UTSW 15 80881162 missense probably damaging 1.00
R1928:Tnrc6b UTSW 15 80880723 missense probably damaging 1.00
R1965:Tnrc6b UTSW 15 80880439 missense probably damaging 1.00
R1966:Tnrc6b UTSW 15 80880439 missense probably damaging 1.00
R2072:Tnrc6b UTSW 15 80882965 missense possibly damaging 0.89
R3084:Tnrc6b UTSW 15 80880247 missense probably damaging 1.00
R3552:Tnrc6b UTSW 15 80880247 missense probably damaging 1.00
R3736:Tnrc6b UTSW 15 80889163 splice site probably benign
R3791:Tnrc6b UTSW 15 80923640 missense probably damaging 1.00
R4170:Tnrc6b UTSW 15 80916787 missense probably benign 0.24
R4276:Tnrc6b UTSW 15 80901971 missense probably benign 0.42
R4519:Tnrc6b UTSW 15 80880247 missense probably damaging 1.00
R5380:Tnrc6b UTSW 15 80879565 missense possibly damaging 0.56
R5470:Tnrc6b UTSW 15 80916711 missense possibly damaging 0.89
R5590:Tnrc6b UTSW 15 80876502 missense probably damaging 0.98
R5982:Tnrc6b UTSW 15 80880816 missense probably benign
R6269:Tnrc6b UTSW 15 80880743 missense probably benign 0.42
R6331:Tnrc6b UTSW 15 80879614 missense probably benign 0.00
R6484:Tnrc6b UTSW 15 80879324 missense possibly damaging 0.92
R6622:Tnrc6b UTSW 15 80879184 missense probably damaging 0.99
R6695:Tnrc6b UTSW 15 80879773 missense probably damaging 1.00
R6728:Tnrc6b UTSW 15 80918526 missense probably damaging 1.00
R6776:Tnrc6b UTSW 15 80924119 missense possibly damaging 0.87
R7159:Tnrc6b UTSW 15 80887022 missense possibly damaging 0.92
R7210:Tnrc6b UTSW 15 80929285 missense probably damaging 1.00
R7287:Tnrc6b UTSW 15 80879541 missense possibly damaging 0.83
R7402:Tnrc6b UTSW 15 80884300 missense probably damaging 1.00
R7479:Tnrc6b UTSW 15 80889126 missense probably benign 0.13
R7533:Tnrc6b UTSW 15 80927741 critical splice donor site probably null
R7571:Tnrc6b UTSW 15 80929393 missense probably benign
R7594:Tnrc6b UTSW 15 80880307 missense possibly damaging 0.66
R7831:Tnrc6b UTSW 15 80880379 missense possibly damaging 0.49
R8208:Tnrc6b UTSW 15 80858700 missense possibly damaging 0.53
R8276:Tnrc6b UTSW 15 80880717 missense probably benign 0.00
R8295:Tnrc6b UTSW 15 80913364 missense probably damaging 1.00
R8351:Tnrc6b UTSW 15 80923490 missense probably damaging 0.99
R8423:Tnrc6b UTSW 15 80929418 missense unknown
R8451:Tnrc6b UTSW 15 80923490 missense probably damaging 0.99
R8725:Tnrc6b UTSW 15 80876452 missense probably damaging 1.00
R8872:Tnrc6b UTSW 15 80918089 missense probably benign 0.23
R9057:Tnrc6b UTSW 15 80879148 missense probably benign
R9240:Tnrc6b UTSW 15 80880061 missense probably damaging 0.98
R9450:Tnrc6b UTSW 15 80880436 missense probably benign 0.01
X0020:Tnrc6b UTSW 15 80882997 missense probably benign 0.16
X0025:Tnrc6b UTSW 15 80881167 missense probably benign 0.03
Z1088:Tnrc6b UTSW 15 80927690 nonsense probably null
Z1177:Tnrc6b UTSW 15 80858699 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- GTCTAGGGGATGCACTAAGC -3'
(R):5'- ATTCGTTCCCAGAACTTGCAG -3'

Sequencing Primer
(F):5'- GATGCACTAAGCTTTCCAGAAG -3'
(R):5'- AGAACTTGCAGCCTGGCATTG -3'
Posted On 2021-11-19