Mutagenetix > Incidental Mutations

Incidental Mutation 'R9029:Tnrc6b'

686959

Institutional Source

Beutler Lab

Gene Symbol

Tnrc6b

Ensembl Gene

ENSMUSG00000047888

Gene Name

trinucleotide repeat containing 6b

Synonyms

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.193) question?

Stock #

R9029 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

80711313-80941085 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 80878978 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 227 (V227A)

Ref Sequence

ENSEMBL: ENSMUSP00000064336 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067689]

AlphaFold

Q8BKI2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000067689
AA Change: V227A

PolyPhen 2 Score 0.832 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000064336
Gene: ENSMUSG00000047888
AA Change: V227A

Domain	Start	End	E-Value	Type
low complexity region	7	19	N/A	INTRINSIC
coiled coil region	33	72	N/A	INTRINSIC
low complexity region	88	106	N/A	INTRINSIC
low complexity region	155	174	N/A	INTRINSIC
low complexity region	207	220	N/A	INTRINSIC
low complexity region	242	260	N/A	INTRINSIC
low complexity region	331	346	N/A	INTRINSIC
low complexity region	363	380	N/A	INTRINSIC
low complexity region	416	425	N/A	INTRINSIC
low complexity region	475	487	N/A	INTRINSIC
internal_repeat_1	488	667	6.43e-5	PROSPERO
low complexity region	858	888	N/A	INTRINSIC
Pfam:Ago_hook	955	1095	1.2e-28	PFAM
coiled coil region	1258	1307	N/A	INTRINSIC
Pfam:TNRC6-PABC_bdg	1339	1623	2.8e-112	PFAM
Pfam:RRM_5	1641	1695	2e-7	PFAM
low complexity region	1705	1721	N/A	INTRINSIC
low complexity region	1748	1769	N/A	INTRINSIC
low complexity region	1792	1809	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000228124

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (56/56)

MGI Phenotype

PHENOTYPE: Mice homozygous for a gene trap allele exhibit neonatal and postnatal lethality with decreased body weight and infertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankrd35	A	T	3: 96,684,144	K582M	probably benign	Het
Catsper3	T	G	13: 55,806,334	V305G	probably damaging	Het
Chd9	G	A	8: 90,956,570	R546Q	unknown	Het
Cnot6l	G	A	5: 96,098,277	T171I	probably benign	Het
Cpne3	A	G	4: 19,535,292	Y247H	possibly damaging	Het
Cramp1l	C	G	17: 25,013,910	A39P	probably damaging	Het
Cyp26b1	A	T	6: 84,577,053	V194E	probably benign	Het
Dchs1	A	G	7: 105,753,712	S3208P	probably benign	Het
Dhrs3	A	G	4: 144,927,185	Y292C	probably damaging	Het
Eif3l	T	C	15: 79,084,212	V227A	probably damaging	Het
Eif4enif1	T	C	11: 3,224,716	V290A	probably damaging	Het
Epb41l4a	A	C	18: 33,878,989	Y159*	probably null	Het
Gm5460	T	A	14: 34,017,369	S103T		Het
Gsto1	A	T	19: 47,864,398	Y224F	probably benign	Het
Hpd	G	A	5: 123,175,910	T271M	probably damaging	Het
Ift74	T	C	4: 94,618,034	I18T	probably benign	Het
Kif12	A	G	4: 63,169,467	C260R	probably damaging	Het
Klk15	C	T	7: 43,938,366	H73Y	possibly damaging	Het
Luc7l3	A	G	11: 94,297,850	V201A	unknown	Het
Mcrip2	T	C	17: 25,864,015	E146G	probably damaging	Het
Mctp1	T	A	13: 76,688,622	Y323N	probably benign	Het
Micu2	T	A	14: 57,918,906	I370F	probably damaging	Het
Mug2	T	A	6: 122,084,369	V1416E	probably damaging	Het
Mup3	T	C	4: 62,085,303	N110D	probably damaging	Het
Nav3	C	T	10: 109,863,752	D294N	possibly damaging	Het
Nphs2	G	A	1: 156,313,022	A110T	probably benign	Het
Olfr1086	A	G	2: 86,676,487	M282T	probably damaging	Het
Olfr403	T	C	11: 74,195,737	I78T	possibly damaging	Het
Olfr811	G	T	10: 129,802,057	P156Q	probably damaging	Het
Otof	C	T	5: 30,370,075		probably null	Het
Pgrmc2	G	T	3: 41,082,670	R109S	probably benign	Het
Plb1	G	A	5: 32,281,735	V214I	probably damaging	Het
Ppp2r5d	C	T	17: 46,687,980	S52N	probably benign	Het
Rrp12	C	A	19: 41,871,279	E1082*	probably null	Het
Skint3	A	G	4: 112,253,954	E92G	probably damaging	Het
Slc12a1	C	G	2: 125,154,084	N52K	probably benign	Het
Smu1	A	G	4: 40,738,361	Y458H	probably damaging	Het
Spsb3	C	T	17: 24,891,532	P317S	unknown	Het
Ssc5d	A	T	7: 4,927,920	Q167L	probably damaging	Het
Ssh2	T	C	11: 77,437,628	V340A	probably damaging	Het
Stag3	G	A	5: 138,298,034	R453H	probably damaging	Het
Svil	T	A	18: 5,056,239	F371I	probably benign	Het
Tas2r140	A	C	6: 133,055,218	S192R	possibly damaging	Het
Tdrp	T	C	8: 13,953,840	I166V	possibly damaging	Het
Tgm3	C	A	2: 130,029,760	Q269K	probably benign	Het
Thsd7b	G	A	1: 130,159,689	C1181Y	probably damaging	Het
Tinag	A	T	9: 77,027,014		probably benign	Het
Tox3	A	C	8: 90,270,236	L133R	possibly damaging	Het
Tshz1	A	T	18: 84,013,514	I923N	probably damaging	Het
Vps13c	T	A	9: 67,948,147	V2498D	probably damaging	Het
Vps41	T	A	13: 18,810,553		probably null	Het
Xylt2	T	C	11: 94,664,636	D850G	probably damaging	Het
Zfp229	T	A	17: 21,745,340	S184T	possibly damaging	Het
Zfp518a	G	A	19: 40,912,781	V385I	probably benign	Het
Zfp595	C	A	13: 67,320,925	M12I	probably benign	Het
Zfp750	T	C	11: 121,512,323	Q533R	probably benign	Het

Other mutations in Tnrc6b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01312:Tnrc6b	APN	15	80923578	missense	probably damaging	1.00
IGL01402:Tnrc6b	APN	15	80880544	missense	possibly damaging	0.71
IGL01505:Tnrc6b	APN	15	80879963	missense	probably benign	0.00
IGL01516:Tnrc6b	APN	15	80902622	missense	possibly damaging	0.93
IGL01584:Tnrc6b	APN	15	80879682	missense	probably benign	0.01
IGL01681:Tnrc6b	APN	15	80879311	splice site	probably null
IGL01909:Tnrc6b	APN	15	80901983	missense	possibly damaging	0.88
IGL01943:Tnrc6b	APN	15	80927695	nonsense	probably null
IGL02253:Tnrc6b	APN	15	80876541	missense	probably damaging	0.99
IGL02260:Tnrc6b	APN	15	80880171	missense	probably damaging	0.99
IGL02437:Tnrc6b	APN	15	80880457	missense	probably damaging	1.00
IGL02541:Tnrc6b	APN	15	80879831	missense	probably benign	0.00
IGL02542:Tnrc6b	APN	15	80902352	missense	possibly damaging	0.83
grosser	UTSW	15	80929285	missense	probably damaging	1.00
heiliger	UTSW	15	80927741	critical splice donor site	probably null
PIT1430001:Tnrc6b	UTSW	15	80929186	missense	probably damaging	0.99
R0092:Tnrc6b	UTSW	15	80918528	missense	probably damaging	1.00
R0165:Tnrc6b	UTSW	15	80858670	splice site	probably null
R0238:Tnrc6b	UTSW	15	80887864	missense	probably damaging	1.00
R0238:Tnrc6b	UTSW	15	80887864	missense	probably damaging	1.00
R0257:Tnrc6b	UTSW	15	80894355	missense	possibly damaging	0.80
R0418:Tnrc6b	UTSW	15	80913323	missense	probably benign	0.27
R0432:Tnrc6b	UTSW	15	80923446	splice site	probably benign
R0487:Tnrc6b	UTSW	15	80880675	missense	probably benign	0.01
R0498:Tnrc6b	UTSW	15	80858719	missense	probably damaging	0.98
R0528:Tnrc6b	UTSW	15	80879403	missense	probably benign	0.00
R0533:Tnrc6b	UTSW	15	80876653	missense	probably benign	0.00
R0571:Tnrc6b	UTSW	15	80913338	missense	probably damaging	1.00
R0650:Tnrc6b	UTSW	15	80784758	missense	probably benign	0.33
R0659:Tnrc6b	UTSW	15	80923446	splice site	probably benign
R0884:Tnrc6b	UTSW	15	80902555	small deletion	probably benign
R1131:Tnrc6b	UTSW	15	80894453	missense	possibly damaging	0.45
R1188:Tnrc6b	UTSW	15	80879229	missense	probably benign
R1479:Tnrc6b	UTSW	15	80887032	splice site	probably null
R1564:Tnrc6b	UTSW	15	80880168	missense	possibly damaging	0.95
R1645:Tnrc6b	UTSW	15	80882958	missense	probably damaging	0.99
R1924:Tnrc6b	UTSW	15	80884206	critical splice acceptor site	probably null
R1926:Tnrc6b	UTSW	15	80881162	missense	probably damaging	1.00
R1928:Tnrc6b	UTSW	15	80880723	missense	probably damaging	1.00
R1965:Tnrc6b	UTSW	15	80880439	missense	probably damaging	1.00
R1966:Tnrc6b	UTSW	15	80880439	missense	probably damaging	1.00
R2072:Tnrc6b	UTSW	15	80882965	missense	possibly damaging	0.89
R3084:Tnrc6b	UTSW	15	80880247	missense	probably damaging	1.00
R3552:Tnrc6b	UTSW	15	80880247	missense	probably damaging	1.00
R3736:Tnrc6b	UTSW	15	80889163	splice site	probably benign
R3791:Tnrc6b	UTSW	15	80923640	missense	probably damaging	1.00
R4170:Tnrc6b	UTSW	15	80916787	missense	probably benign	0.24
R4276:Tnrc6b	UTSW	15	80901971	missense	probably benign	0.42
R4519:Tnrc6b	UTSW	15	80880247	missense	probably damaging	1.00
R5380:Tnrc6b	UTSW	15	80879565	missense	possibly damaging	0.56
R5470:Tnrc6b	UTSW	15	80916711	missense	possibly damaging	0.89
R5590:Tnrc6b	UTSW	15	80876502	missense	probably damaging	0.98
R5982:Tnrc6b	UTSW	15	80880816	missense	probably benign
R6269:Tnrc6b	UTSW	15	80880743	missense	probably benign	0.42
R6331:Tnrc6b	UTSW	15	80879614	missense	probably benign	0.00
R6484:Tnrc6b	UTSW	15	80879324	missense	possibly damaging	0.92
R6622:Tnrc6b	UTSW	15	80879184	missense	probably damaging	0.99
R6695:Tnrc6b	UTSW	15	80879773	missense	probably damaging	1.00
R6728:Tnrc6b	UTSW	15	80918526	missense	probably damaging	1.00
R6776:Tnrc6b	UTSW	15	80924119	missense	possibly damaging	0.87
R7159:Tnrc6b	UTSW	15	80887022	missense	possibly damaging	0.92
R7210:Tnrc6b	UTSW	15	80929285	missense	probably damaging	1.00
R7287:Tnrc6b	UTSW	15	80879541	missense	possibly damaging	0.83
R7402:Tnrc6b	UTSW	15	80884300	missense	probably damaging	1.00
R7479:Tnrc6b	UTSW	15	80889126	missense	probably benign	0.13
R7533:Tnrc6b	UTSW	15	80927741	critical splice donor site	probably null
R7571:Tnrc6b	UTSW	15	80929393	missense	probably benign
R7594:Tnrc6b	UTSW	15	80880307	missense	possibly damaging	0.66
R7831:Tnrc6b	UTSW	15	80880379	missense	possibly damaging	0.49
R8208:Tnrc6b	UTSW	15	80858700	missense	possibly damaging	0.53
R8276:Tnrc6b	UTSW	15	80880717	missense	probably benign	0.00
R8295:Tnrc6b	UTSW	15	80913364	missense	probably damaging	1.00
R8351:Tnrc6b	UTSW	15	80923490	missense	probably damaging	0.99
R8423:Tnrc6b	UTSW	15	80929418	missense	unknown
R8451:Tnrc6b	UTSW	15	80923490	missense	probably damaging	0.99
R8725:Tnrc6b	UTSW	15	80876452	missense	probably damaging	1.00
R8872:Tnrc6b	UTSW	15	80918089	missense	probably benign	0.23
R9057:Tnrc6b	UTSW	15	80879148	missense	probably benign
R9240:Tnrc6b	UTSW	15	80880061	missense	probably damaging	0.98
R9450:Tnrc6b	UTSW	15	80880436	missense	probably benign	0.01
X0020:Tnrc6b	UTSW	15	80882997	missense	probably benign	0.16
X0025:Tnrc6b	UTSW	15	80881167	missense	probably benign	0.03
Z1088:Tnrc6b	UTSW	15	80927690	nonsense	probably null
Z1177:Tnrc6b	UTSW	15	80858699	missense	possibly damaging	0.68

Predicted Primers

PCR Primer
(F):5'- GTCTAGGGGATGCACTAAGC -3'
(R):5'- ATTCGTTCCCAGAACTTGCAG -3'

Sequencing Primer
(F):5'- GATGCACTAAGCTTTCCAGAAG -3'
(R):5'- AGAACTTGCAGCCTGGCATTG -3'

Posted On

2021-11-19