Incidental Mutation 'R9029:Cramp1'
ID 686962
Institutional Source Beutler Lab
Gene Symbol Cramp1
Ensembl Gene ENSMUSG00000038002
Gene Name cramped chromatin regulator 1
Synonyms 5830477H08Rik, Tce4, Cramp1l
MMRRC Submission 068858-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9029 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 25180200-25234762 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to G at 25232884 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Proline at position 39 (A39P)
Ref Sequence ENSEMBL: ENSMUSP00000073060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024983] [ENSMUST00000073337] [ENSMUST00000137386]
AlphaFold Q6PG95
Predicted Effect probably benign
Transcript: ENSMUST00000024983
SMART Domains Protein: ENSMUSP00000024983
Gene: ENSMUSG00000024169

DomainStartEndE-ValueType
WD40 55 89 6.14e1 SMART
WD40 91 131 1.49e0 SMART
Blast:WD40 252 304 3e-15 BLAST
WD40 308 352 2.76e0 SMART
Blast:WD40 364 405 8e-17 BLAST
Blast:WD40 510 547 6e-13 BLAST
Blast:WD40 560 603 3e-7 BLAST
Blast:TPR 863 896 9e-13 BLAST
Blast:TPR 1011 1044 1e-13 BLAST
Blast:TPR 1377 1410 8e-13 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000073337
AA Change: A39P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000073060
Gene: ENSMUSG00000038002
AA Change: A39P

DomainStartEndE-ValueType
low complexity region 11 20 N/A INTRINSIC
low complexity region 29 43 N/A INTRINSIC
low complexity region 51 64 N/A INTRINSIC
low complexity region 100 126 N/A INTRINSIC
low complexity region 134 147 N/A INTRINSIC
SANT 159 219 3.68e-3 SMART
low complexity region 479 503 N/A INTRINSIC
low complexity region 548 562 N/A INTRINSIC
low complexity region 792 803 N/A INTRINSIC
low complexity region 833 845 N/A INTRINSIC
low complexity region 889 903 N/A INTRINSIC
low complexity region 1069 1086 N/A INTRINSIC
low complexity region 1113 1124 N/A INTRINSIC
low complexity region 1141 1156 N/A INTRINSIC
low complexity region 1171 1185 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137386
SMART Domains Protein: ENSMUSP00000116163
Gene: ENSMUSG00000024169

DomainStartEndE-ValueType
WD40 55 89 6.14e1 SMART
WD40 91 131 1.49e0 SMART
Blast:WD40 252 304 3e-15 BLAST
WD40 308 352 2.76e0 SMART
Blast:WD40 364 405 1e-16 BLAST
Blast:WD40 510 547 5e-13 BLAST
Blast:WD40 560 603 3e-7 BLAST
Blast:TPR 863 896 8e-13 BLAST
Blast:TPR 1011 1044 9e-14 BLAST
Meta Mutation Damage Score 0.0695 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (56/56)
MGI Phenotype PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd35 A T 3: 96,591,460 (GRCm39) K582M probably benign Het
Catsper3 T G 13: 55,954,147 (GRCm39) V305G probably damaging Het
Chd9 G A 8: 91,683,198 (GRCm39) R546Q unknown Het
Cnot6l G A 5: 96,246,136 (GRCm39) T171I probably benign Het
Cpne3 A G 4: 19,535,292 (GRCm39) Y247H possibly damaging Het
Cyp26b1 A T 6: 84,554,035 (GRCm39) V194E probably benign Het
Dchs1 A G 7: 105,402,919 (GRCm39) S3208P probably benign Het
Dhrs3 A G 4: 144,653,755 (GRCm39) Y292C probably damaging Het
Eif3l T C 15: 78,968,412 (GRCm39) V227A probably damaging Het
Eif4enif1 T C 11: 3,174,716 (GRCm39) V290A probably damaging Het
Epb41l4a A C 18: 34,012,042 (GRCm39) Y159* probably null Het
Gm5460 T A 14: 33,739,326 (GRCm39) S103T Het
Gsto1 A T 19: 47,852,837 (GRCm39) Y224F probably benign Het
Hpd G A 5: 123,313,973 (GRCm39) T271M probably damaging Het
Ift74 T C 4: 94,506,271 (GRCm39) I18T probably benign Het
Kif12 A G 4: 63,087,704 (GRCm39) C260R probably damaging Het
Klk15 C T 7: 43,587,790 (GRCm39) H73Y possibly damaging Het
Luc7l3 A G 11: 94,188,676 (GRCm39) V201A unknown Het
Mcrip2 T C 17: 26,082,989 (GRCm39) E146G probably damaging Het
Mctp1 T A 13: 76,836,741 (GRCm39) Y323N probably benign Het
Micu2 T A 14: 58,156,363 (GRCm39) I370F probably damaging Het
Mug2 T A 6: 122,061,328 (GRCm39) V1416E probably damaging Het
Mup3 T C 4: 62,003,540 (GRCm39) N110D probably damaging Het
Nav3 C T 10: 109,699,613 (GRCm39) D294N possibly damaging Het
Nphs2 G A 1: 156,140,592 (GRCm39) A110T probably benign Het
Or1a1 T C 11: 74,086,563 (GRCm39) I78T possibly damaging Het
Or5t7 A G 2: 86,506,831 (GRCm39) M282T probably damaging Het
Or6c215 G T 10: 129,637,926 (GRCm39) P156Q probably damaging Het
Otof C T 5: 30,527,419 (GRCm39) probably null Het
Pgrmc2 G T 3: 41,037,105 (GRCm39) R109S probably benign Het
Plb1 G A 5: 32,439,079 (GRCm39) V214I probably damaging Het
Ppp2r5d C T 17: 46,998,906 (GRCm39) S52N probably benign Het
Rrp12 C A 19: 41,859,718 (GRCm39) E1082* probably null Het
Skint3 A G 4: 112,111,151 (GRCm39) E92G probably damaging Het
Slc12a1 C G 2: 124,996,004 (GRCm39) N52K probably benign Het
Smu1 A G 4: 40,738,361 (GRCm39) Y458H probably damaging Het
Spsb3 C T 17: 25,110,506 (GRCm39) P317S unknown Het
Ssc5d A T 7: 4,930,919 (GRCm39) Q167L probably damaging Het
Ssh2 T C 11: 77,328,454 (GRCm39) V340A probably damaging Het
Stag3 G A 5: 138,296,296 (GRCm39) R453H probably damaging Het
Svil T A 18: 5,056,239 (GRCm39) F371I probably benign Het
Tas2r140 A C 6: 133,032,181 (GRCm39) S192R possibly damaging Het
Tdrp T C 8: 14,003,840 (GRCm39) I166V possibly damaging Het
Tgm3 C A 2: 129,871,680 (GRCm39) Q269K probably benign Het
Thsd7b G A 1: 130,087,426 (GRCm39) C1181Y probably damaging Het
Tinag A T 9: 76,934,296 (GRCm39) probably benign Het
Tnrc6b T C 15: 80,763,179 (GRCm39) V227A possibly damaging Het
Tox3 A C 8: 90,996,864 (GRCm39) L133R possibly damaging Het
Tshz1 A T 18: 84,031,639 (GRCm39) I923N probably damaging Het
Vps13c T A 9: 67,855,429 (GRCm39) V2498D probably damaging Het
Vps41 T A 13: 18,994,723 (GRCm39) probably null Het
Xylt2 T C 11: 94,555,462 (GRCm39) D850G probably damaging Het
Zfp229 T A 17: 21,964,321 (GRCm39) S184T possibly damaging Het
Zfp518a G A 19: 40,901,225 (GRCm39) V385I probably benign Het
Zfp595 C A 13: 67,468,989 (GRCm39) M12I probably benign Het
Zfp750 T C 11: 121,403,149 (GRCm39) Q533R probably benign Het
Other mutations in Cramp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Cramp1 APN 17 25,202,925 (GRCm39) missense probably benign 0.11
IGL01360:Cramp1 APN 17 25,216,547 (GRCm39) missense probably damaging 1.00
IGL01966:Cramp1 APN 17 25,201,917 (GRCm39) missense probably benign 0.01
IGL02211:Cramp1 APN 17 25,196,610 (GRCm39) missense possibly damaging 0.94
IGL02474:Cramp1 APN 17 25,204,024 (GRCm39) missense probably damaging 0.98
IGL02798:Cramp1 APN 17 25,187,894 (GRCm39) splice site probably benign
IGL03340:Cramp1 APN 17 25,192,516 (GRCm39) missense probably damaging 1.00
Interred UTSW 17 25,202,956 (GRCm39) missense probably damaging 0.99
R0106:Cramp1 UTSW 17 25,191,350 (GRCm39) missense probably benign 0.30
R1054:Cramp1 UTSW 17 25,202,151 (GRCm39) missense probably damaging 1.00
R1220:Cramp1 UTSW 17 25,201,211 (GRCm39) missense probably damaging 1.00
R1341:Cramp1 UTSW 17 25,196,514 (GRCm39) missense probably damaging 1.00
R1491:Cramp1 UTSW 17 25,191,323 (GRCm39) missense probably benign 0.17
R1610:Cramp1 UTSW 17 25,202,925 (GRCm39) missense probably benign 0.11
R1649:Cramp1 UTSW 17 25,202,217 (GRCm39) missense probably damaging 1.00
R1795:Cramp1 UTSW 17 25,183,884 (GRCm39) missense probably damaging 1.00
R1856:Cramp1 UTSW 17 25,187,952 (GRCm39) missense probably damaging 1.00
R1881:Cramp1 UTSW 17 25,196,656 (GRCm39) splice site probably benign
R1968:Cramp1 UTSW 17 25,183,913 (GRCm39) missense probably damaging 1.00
R2047:Cramp1 UTSW 17 25,222,189 (GRCm39) nonsense probably null
R2099:Cramp1 UTSW 17 25,192,059 (GRCm39) missense probably benign 0.01
R2298:Cramp1 UTSW 17 25,216,454 (GRCm39) missense probably damaging 0.96
R3752:Cramp1 UTSW 17 25,190,532 (GRCm39) missense probably damaging 1.00
R3821:Cramp1 UTSW 17 25,193,756 (GRCm39) missense probably damaging 1.00
R3861:Cramp1 UTSW 17 25,216,588 (GRCm39) splice site probably benign
R4399:Cramp1 UTSW 17 25,198,559 (GRCm39) missense probably damaging 1.00
R4847:Cramp1 UTSW 17 25,204,063 (GRCm39) missense probably damaging 1.00
R4883:Cramp1 UTSW 17 25,201,293 (GRCm39) missense probably benign
R5579:Cramp1 UTSW 17 25,192,087 (GRCm39) missense possibly damaging 0.89
R5631:Cramp1 UTSW 17 25,204,577 (GRCm39) missense possibly damaging 0.93
R5716:Cramp1 UTSW 17 25,193,709 (GRCm39) missense probably damaging 0.99
R6589:Cramp1 UTSW 17 25,196,466 (GRCm39) splice site probably null
R6631:Cramp1 UTSW 17 25,202,931 (GRCm39) missense probably benign 0.40
R7307:Cramp1 UTSW 17 25,193,719 (GRCm39) missense possibly damaging 0.94
R7323:Cramp1 UTSW 17 25,201,379 (GRCm39) missense possibly damaging 0.90
R7672:Cramp1 UTSW 17 25,201,440 (GRCm39) missense probably damaging 0.96
R7832:Cramp1 UTSW 17 25,202,196 (GRCm39) missense probably damaging 0.96
R8071:Cramp1 UTSW 17 25,201,674 (GRCm39) missense probably damaging 0.99
R8244:Cramp1 UTSW 17 25,190,384 (GRCm39) missense probably damaging 1.00
R8430:Cramp1 UTSW 17 25,196,536 (GRCm39) missense probably damaging 1.00
R8783:Cramp1 UTSW 17 25,193,732 (GRCm39) missense probably damaging 0.99
R8890:Cramp1 UTSW 17 25,202,114 (GRCm39) missense probably damaging 1.00
R8892:Cramp1 UTSW 17 25,202,114 (GRCm39) missense probably damaging 1.00
R8894:Cramp1 UTSW 17 25,202,114 (GRCm39) missense probably damaging 1.00
R8937:Cramp1 UTSW 17 25,202,956 (GRCm39) missense probably damaging 0.99
R8941:Cramp1 UTSW 17 25,202,114 (GRCm39) missense probably damaging 1.00
R9047:Cramp1 UTSW 17 25,198,603 (GRCm39) missense possibly damaging 0.90
R9149:Cramp1 UTSW 17 25,187,920 (GRCm39) missense probably damaging 0.99
R9262:Cramp1 UTSW 17 25,232,920 (GRCm39) missense probably damaging 0.99
R9460:Cramp1 UTSW 17 25,222,281 (GRCm39) missense probably damaging 1.00
R9614:Cramp1 UTSW 17 25,201,783 (GRCm39) missense probably damaging 1.00
R9615:Cramp1 UTSW 17 25,201,783 (GRCm39) missense probably damaging 1.00
R9651:Cramp1 UTSW 17 25,201,783 (GRCm39) missense probably damaging 1.00
R9652:Cramp1 UTSW 17 25,201,783 (GRCm39) missense probably damaging 1.00
R9653:Cramp1 UTSW 17 25,201,783 (GRCm39) missense probably damaging 1.00
R9665:Cramp1 UTSW 17 25,196,545 (GRCm39) missense probably damaging 1.00
R9753:Cramp1 UTSW 17 25,191,320 (GRCm39) missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- CCACAGGATAGGTCCCTACC -3'
(R):5'- GGTAAACTTCTGCCTGCCGC -3'

Sequencing Primer
(F):5'- CGCTGGCACCACCACTG -3'
(R):5'- CAGGATGACAGTGAAGTTG -3'
Posted On 2021-11-19