Incidental Mutation 'R9030:Actr5'
ID 686979
Institutional Source Beutler Lab
Gene Symbol Actr5
Ensembl Gene ENSMUSG00000037761
Gene Name ARP5 actin-related protein 5
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9030 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 158624888-158639211 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 158632401 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 375 (I375L)
Ref Sequence ENSEMBL: ENSMUSP00000046658 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045644] [ENSMUST00000183731]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000045644
AA Change: I375L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000046658
Gene: ENSMUSG00000037761
AA Change: I375L

DomainStartEndE-ValueType
ACTIN 30 571 1.15e-36 SMART
low complexity region 593 605 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183731
AA Change: I375L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139110
Gene: ENSMUSG00000037761
AA Change: I375L

DomainStartEndE-ValueType
ACTIN 30 399 3.1e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik T C 12: 55,379,407 F514S probably damaging Het
Adgrl2 G T 3: 148,839,125 T778K possibly damaging Het
Cdc73 A T 1: 143,609,496 L478H probably damaging Het
Cdh7 C A 1: 110,100,113 H529Q probably benign Het
Cep55 T C 19: 38,071,144 probably null Het
Chd9 G A 8: 90,956,570 R546Q unknown Het
Ddit4 A T 10: 59,950,693 L178Q probably damaging Het
Dgke A T 11: 89,050,411 N315K possibly damaging Het
Dsg1a A G 18: 20,340,492 D874G probably damaging Het
Dsp T A 13: 38,168,697 Y184N probably damaging Het
Dynlt1c A G 17: 6,603,517 I20V probably benign Het
Ephx4 A G 5: 107,429,683 H291R possibly damaging Het
Epx A T 11: 87,872,644 M250K probably benign Het
Fan1 T C 7: 64,373,013 Y164C probably benign Het
Fer1l6 A T 15: 58,630,745 Y1365F probably damaging Het
Fndc8 A G 11: 82,898,696 T227A probably benign Het
Gbp7 T C 3: 142,538,037 I115T probably damaging Het
Gm5145 A G 17: 20,571,008 E216G probably benign Het
Gm94 A T 18: 43,781,261 F77L possibly damaging Het
Grik3 C A 4: 125,632,392 H139Q probably benign Het
Gucy2e T C 11: 69,225,001 T852A probably damaging Het
Hif1a T C 12: 73,936,236 S274P probably damaging Het
Hmcn1 T A 1: 150,817,119 I268L probably benign Het
Klk15 C T 7: 43,938,366 H73Y possibly damaging Het
Lin52 T A 12: 84,545,907 S87T Het
Lrrc74b A G 16: 17,549,776 probably null Het
Mapk10 T C 5: 102,996,633 K136R probably damaging Het
Nlrp2 A T 7: 5,322,458 N738K probably null Het
Nlrp5 A T 7: 23,430,148 Q880L possibly damaging Het
Nov A T 15: 54,752,291 Y284F probably damaging Het
Olfr1167 A T 2: 88,149,374 I215N possibly damaging Het
Olfr1381 T A 11: 49,551,981 V78E probably damaging Het
Olfr811 G T 10: 129,802,057 P156Q probably damaging Het
P4htm G A 9: 108,597,428 P46L probably benign Het
Pcsk4 A T 10: 80,329,024 H69Q probably damaging Het
Pdzd2 A G 15: 12,374,299 S1917P probably benign Het
Pnpla5 A G 15: 84,113,886 V385A possibly damaging Het
Rims2 C T 15: 39,476,477 R856C probably damaging Het
Rprd2 A G 3: 95,784,310 Y218H probably benign Het
Sat2 T A 11: 69,622,243 probably benign Het
Sf1 C T 19: 6,376,306 R186C Het
Snrnp200 A G 2: 127,211,546 probably benign Het
Sqor A T 2: 122,787,594 D124V probably benign Het
Ssh2 A G 11: 77,421,236 H191R possibly damaging Het
Stac C A 9: 111,690,252 probably benign Het
Svs4 T C 2: 164,277,138 M93V unknown Het
Tbc1d32 A T 10: 56,161,145 S668T possibly damaging Het
Tex10 A G 4: 48,452,056 F690S probably damaging Het
Tex30 A G 1: 44,091,196 M88T Het
Tgfbrap1 T C 1: 43,056,677 T534A probably benign Het
Tmco1 C T 1: 167,308,563 probably benign Het
Tnrc18 T C 5: 142,726,063 E2647G probably damaging Het
Trim43a GATTTATTTATTTATTTATTTATTTATTTATTTATTTATT GATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATT 9: 88,582,989 probably benign Het
Tubb3 A T 8: 123,418,957 R62W probably damaging Het
Vmn2r108 A G 17: 20,470,050 S507P probably benign Het
Vmn2r116 A G 17: 23,384,890 K30E possibly damaging Het
Vmn2r14 G A 5: 109,220,188 H313Y probably damaging Het
Wdr37 C T 13: 8,835,388 V340M probably damaging Het
Zfp799 A G 17: 32,820,591 F234L possibly damaging Het
Other mutations in Actr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01609:Actr5 APN 2 158636802 critical splice donor site probably null
IGL02622:Actr5 APN 2 158638808 missense probably benign 0.03
IGL02707:Actr5 APN 2 158636697 missense probably benign 0.45
R0610:Actr5 UTSW 2 158632456 critical splice donor site probably null
R1467:Actr5 UTSW 2 158638697 missense probably benign 0.02
R1467:Actr5 UTSW 2 158638697 missense probably benign 0.02
R1720:Actr5 UTSW 2 158636137 missense possibly damaging 0.93
R1869:Actr5 UTSW 2 158638723 missense probably damaging 0.99
R1937:Actr5 UTSW 2 158636029 missense possibly damaging 0.63
R2051:Actr5 UTSW 2 158632293 missense probably benign 0.00
R2389:Actr5 UTSW 2 158625212 missense probably benign
R2420:Actr5 UTSW 2 158636081 missense probably damaging 1.00
R2422:Actr5 UTSW 2 158636081 missense probably damaging 1.00
R2909:Actr5 UTSW 2 158625220 missense possibly damaging 0.52
R4089:Actr5 UTSW 2 158625102 utr 5 prime probably benign
R4719:Actr5 UTSW 2 158626513 missense probably damaging 0.97
R4737:Actr5 UTSW 2 158628071 missense probably damaging 1.00
R4820:Actr5 UTSW 2 158625506 missense probably damaging 1.00
R5010:Actr5 UTSW 2 158635363 missense probably benign 0.00
R5341:Actr5 UTSW 2 158625224 nonsense probably null
R5457:Actr5 UTSW 2 158635998 splice site probably null
R6328:Actr5 UTSW 2 158635344 missense possibly damaging 0.72
R7158:Actr5 UTSW 2 158626414 missense possibly damaging 0.95
R8526:Actr5 UTSW 2 158632304 missense probably damaging 1.00
R8789:Actr5 UTSW 2 158636684 nonsense probably null
R9000:Actr5 UTSW 2 158636690 missense probably benign 0.00
R9222:Actr5 UTSW 2 158631503 missense probably damaging 0.98
R9316:Actr5 UTSW 2 158635354 missense probably benign 0.00
R9563:Actr5 UTSW 2 158628215 missense probably damaging 1.00
R9564:Actr5 UTSW 2 158628215 missense probably damaging 1.00
R9565:Actr5 UTSW 2 158628215 missense probably damaging 1.00
R9588:Actr5 UTSW 2 158626408 missense possibly damaging 0.94
Z1177:Actr5 UTSW 2 158636705 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CCGTCTCTGAGAGTGACTTG -3'
(R):5'- AAGCCGACTCAATGGCTTG -3'

Sequencing Primer
(F):5'- AGAGTGACTTGTGACTGCTC -3'
(R):5'- AAGGTCATCTCGGCTACATG -3'
Posted On 2021-11-19