Incidental Mutation 'R9030:Fer1l6'
ID 687017
Institutional Source Beutler Lab
Gene Symbol Fer1l6
Ensembl Gene ENSMUSG00000037106
Gene Name fer-1-like 6 (C. elegans)
Synonyms EG631797
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock # R9030 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 58510048-58665092 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 58630745 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 1365 (Y1365F)
Ref Sequence ENSEMBL: ENSMUSP00000125718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161028]
AlphaFold E0CZ42
Predicted Effect probably damaging
Transcript: ENSMUST00000161028
AA Change: Y1365F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125718
Gene: ENSMUSG00000037106
AA Change: Y1365F

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
C2 83 179 4.09e-12 SMART
FerI 165 235 2.06e-36 SMART
C2 243 354 5.19e-14 SMART
low complexity region 412 449 N/A INTRINSIC
FerB 714 787 2.53e-45 SMART
C2 829 936 8.84e-8 SMART
C2 1000 1099 3.05e0 SMART
low complexity region 1189 1203 N/A INTRINSIC
low complexity region 1256 1270 N/A INTRINSIC
C2 1361 1460 5.78e-12 SMART
low complexity region 1518 1529 N/A INTRINSIC
C2 1601 1731 1.01e-2 SMART
Pfam:Ferlin_C 1765 1857 2.3e-40 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik T C 12: 55,379,407 F514S probably damaging Het
Actr5 A C 2: 158,632,401 I375L probably benign Het
Adgrl2 G T 3: 148,839,125 T778K possibly damaging Het
Cdc73 A T 1: 143,609,496 L478H probably damaging Het
Cdh7 C A 1: 110,100,113 H529Q probably benign Het
Cep55 T C 19: 38,071,144 probably null Het
Chd9 G A 8: 90,956,570 R546Q unknown Het
Ddit4 A T 10: 59,950,693 L178Q probably damaging Het
Dgke A T 11: 89,050,411 N315K possibly damaging Het
Dsg1a A G 18: 20,340,492 D874G probably damaging Het
Dsp T A 13: 38,168,697 Y184N probably damaging Het
Dynlt1c A G 17: 6,603,517 I20V probably benign Het
Ephx4 A G 5: 107,429,683 H291R possibly damaging Het
Epx A T 11: 87,872,644 M250K probably benign Het
Fan1 T C 7: 64,373,013 Y164C probably benign Het
Fndc8 A G 11: 82,898,696 T227A probably benign Het
Gbp7 T C 3: 142,538,037 I115T probably damaging Het
Gm5145 A G 17: 20,571,008 E216G probably benign Het
Gm94 A T 18: 43,781,261 F77L possibly damaging Het
Grik3 C A 4: 125,632,392 H139Q probably benign Het
Gucy2e T C 11: 69,225,001 T852A probably damaging Het
Hif1a T C 12: 73,936,236 S274P probably damaging Het
Hmcn1 T A 1: 150,817,119 I268L probably benign Het
Klk15 C T 7: 43,938,366 H73Y possibly damaging Het
Lin52 T A 12: 84,545,907 S87T Het
Lrrc74b A G 16: 17,549,776 probably null Het
Mapk10 T C 5: 102,996,633 K136R probably damaging Het
Nlrp2 A T 7: 5,322,458 N738K probably null Het
Nlrp5 A T 7: 23,430,148 Q880L possibly damaging Het
Nov A T 15: 54,752,291 Y284F probably damaging Het
Olfr1167 A T 2: 88,149,374 I215N possibly damaging Het
Olfr1381 T A 11: 49,551,981 V78E probably damaging Het
Olfr811 G T 10: 129,802,057 P156Q probably damaging Het
P4htm G A 9: 108,597,428 P46L probably benign Het
Pcsk4 A T 10: 80,329,024 H69Q probably damaging Het
Pdzd2 A G 15: 12,374,299 S1917P probably benign Het
Pnpla5 A G 15: 84,113,886 V385A possibly damaging Het
Rims2 C T 15: 39,476,477 R856C probably damaging Het
Rprd2 A G 3: 95,784,310 Y218H probably benign Het
Sat2 T A 11: 69,622,243 probably benign Het
Sf1 C T 19: 6,376,306 R186C Het
Snrnp200 A G 2: 127,211,546 probably benign Het
Sqor A T 2: 122,787,594 D124V probably benign Het
Ssh2 A G 11: 77,421,236 H191R possibly damaging Het
Stac C A 9: 111,690,252 probably benign Het
Svs4 T C 2: 164,277,138 M93V unknown Het
Tbc1d32 A T 10: 56,161,145 S668T possibly damaging Het
Tex10 A G 4: 48,452,056 F690S probably damaging Het
Tex30 A G 1: 44,091,196 M88T Het
Tgfbrap1 T C 1: 43,056,677 T534A probably benign Het
Tmco1 C T 1: 167,308,563 probably benign Het
Tnrc18 T C 5: 142,726,063 E2647G probably damaging Het
Trim43a GATTTATTTATTTATTTATTTATTTATTTATTTATTTATT GATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATT 9: 88,582,989 probably benign Het
Tubb3 A T 8: 123,418,957 R62W probably damaging Het
Vmn2r108 A G 17: 20,470,050 S507P probably benign Het
Vmn2r116 A G 17: 23,384,890 K30E possibly damaging Het
Vmn2r14 G A 5: 109,220,188 H313Y probably damaging Het
Wdr37 C T 13: 8,835,388 V340M probably damaging Het
Zfp799 A G 17: 32,820,591 F234L possibly damaging Het
Other mutations in Fer1l6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0009:Fer1l6 UTSW 15 58662787 missense probably damaging 1.00
R0141:Fer1l6 UTSW 15 58558402 missense probably damaging 1.00
R0178:Fer1l6 UTSW 15 58637914 splice site probably null
R0304:Fer1l6 UTSW 15 58590562 missense probably benign 0.08
R0379:Fer1l6 UTSW 15 58548338 missense probably benign 0.05
R0457:Fer1l6 UTSW 15 58638094 critical splice donor site probably null
R0546:Fer1l6 UTSW 15 58558408 splice site probably null
R0602:Fer1l6 UTSW 15 58577945 missense probably damaging 0.98
R0619:Fer1l6 UTSW 15 58662935 splice site probably null
R0669:Fer1l6 UTSW 15 58553724 splice site probably null
R0854:Fer1l6 UTSW 15 58559188 missense probably benign 0.00
R0948:Fer1l6 UTSW 15 58564075 missense probably benign 0.00
R1180:Fer1l6 UTSW 15 58602311 splice site probably benign
R1483:Fer1l6 UTSW 15 58637970 missense possibly damaging 0.84
R1627:Fer1l6 UTSW 15 58641879 missense probably benign 0.41
R1635:Fer1l6 UTSW 15 58647081 missense probably damaging 1.00
R1834:Fer1l6 UTSW 15 58557869 missense possibly damaging 0.58
R1921:Fer1l6 UTSW 15 58625231 missense probably damaging 1.00
R2000:Fer1l6 UTSW 15 58602311 splice site probably benign
R2041:Fer1l6 UTSW 15 58558306 missense probably damaging 1.00
R2144:Fer1l6 UTSW 15 58627534 missense probably benign
R2145:Fer1l6 UTSW 15 58627534 missense probably benign
R2981:Fer1l6 UTSW 15 58564077 missense probably damaging 0.99
R4164:Fer1l6 UTSW 15 58559238 missense possibly damaging 0.83
R4192:Fer1l6 UTSW 15 58647149 missense probably damaging 1.00
R4273:Fer1l6 UTSW 15 58627522 missense probably benign 0.41
R4573:Fer1l6 UTSW 15 58626280 critical splice donor site probably null
R4581:Fer1l6 UTSW 15 58640226 missense probably damaging 1.00
R4624:Fer1l6 UTSW 15 58553705 missense probably damaging 1.00
R4755:Fer1l6 UTSW 15 58640211 missense probably benign 0.09
R4774:Fer1l6 UTSW 15 58577949 missense probably damaging 0.99
R4894:Fer1l6 UTSW 15 58618902 missense probably damaging 1.00
R4896:Fer1l6 UTSW 15 58638020 missense probably damaging 1.00
R4921:Fer1l6 UTSW 15 58600311 critical splice acceptor site probably null
R4962:Fer1l6 UTSW 15 58571401 missense probably benign 0.03
R5029:Fer1l6 UTSW 15 58643920 missense probably benign 0.00
R5134:Fer1l6 UTSW 15 58640154 missense probably damaging 1.00
R5175:Fer1l6 UTSW 15 58550277 missense probably damaging 1.00
R5227:Fer1l6 UTSW 15 58581903 nonsense probably null
R5561:Fer1l6 UTSW 15 58660825 missense probably damaging 0.97
R5621:Fer1l6 UTSW 15 58558326 missense probably damaging 1.00
R5670:Fer1l6 UTSW 15 58622482 missense probably benign 0.00
R5745:Fer1l6 UTSW 15 58571389 missense probably benign 0.01
R5807:Fer1l6 UTSW 15 58590550 nonsense probably null
R5823:Fer1l6 UTSW 15 58590503 nonsense probably null
R5892:Fer1l6 UTSW 15 58564068 missense probably benign
R6006:Fer1l6 UTSW 15 58647044 missense probably damaging 1.00
R6137:Fer1l6 UTSW 15 58559206 missense probably damaging 0.97
R6195:Fer1l6 UTSW 15 58637957 missense probably damaging 1.00
R6234:Fer1l6 UTSW 15 58560639 missense probably damaging 1.00
R6237:Fer1l6 UTSW 15 58625177 nonsense probably null
R6237:Fer1l6 UTSW 15 58638006 missense probably damaging 1.00
R6271:Fer1l6 UTSW 15 58641918 missense probably benign 0.01
R6336:Fer1l6 UTSW 15 58559232 nonsense probably null
R6784:Fer1l6 UTSW 15 58571426 missense possibly damaging 0.63
R6852:Fer1l6 UTSW 15 58594878 missense probably damaging 1.00
R7030:Fer1l6 UTSW 15 58629378 missense probably damaging 1.00
R7088:Fer1l6 UTSW 15 58564050 missense possibly damaging 0.69
R7181:Fer1l6 UTSW 15 58575297 missense probably benign 0.00
R7226:Fer1l6 UTSW 15 58590535 missense probably benign 0.00
R7266:Fer1l6 UTSW 15 58627597 missense probably benign
R7463:Fer1l6 UTSW 15 58573601 nonsense probably null
R7464:Fer1l6 UTSW 15 58573247 splice site probably null
R7469:Fer1l6 UTSW 15 58590570 splice site probably null
R7483:Fer1l6 UTSW 15 58641945 missense possibly damaging 0.83
R7491:Fer1l6 UTSW 15 58600432 missense probably damaging 1.00
R7534:Fer1l6 UTSW 15 58638026 missense probably damaging 1.00
R7562:Fer1l6 UTSW 15 58560482 missense probably benign 0.00
R7580:Fer1l6 UTSW 15 58558396 missense probably benign 0.41
R7599:Fer1l6 UTSW 15 58627589 missense probably benign
R7607:Fer1l6 UTSW 15 58662732 nonsense probably null
R7677:Fer1l6 UTSW 15 58602290 missense probably benign 0.00
R8202:Fer1l6 UTSW 15 58630637 missense probably damaging 1.00
R8261:Fer1l6 UTSW 15 58560496 missense possibly damaging 0.84
R8847:Fer1l6 UTSW 15 58542163 missense possibly damaging 0.72
R9022:Fer1l6 UTSW 15 58583480 missense probably damaging 0.99
R9160:Fer1l6 UTSW 15 58643866 missense possibly damaging 0.94
R9180:Fer1l6 UTSW 15 58622381 missense probably benign 0.19
R9289:Fer1l6 UTSW 15 58618917 missense probably damaging 1.00
R9559:Fer1l6 UTSW 15 58557910 missense possibly damaging 0.88
R9562:Fer1l6 UTSW 15 58618521 missense possibly damaging 0.70
R9682:Fer1l6 UTSW 15 58550264 missense probably benign 0.03
R9775:Fer1l6 UTSW 15 58625249 missense probably benign
X0021:Fer1l6 UTSW 15 58569202 nonsense probably null
X0027:Fer1l6 UTSW 15 58629340 missense probably damaging 1.00
X0063:Fer1l6 UTSW 15 58618574 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTTCCACCACAGGGCTCAC -3'
(R):5'- GAAACTTAATGGGATTGGACCTATGG -3'

Sequencing Primer
(F):5'- ACAGGGCTCACTATGGTTTC -3'
(R):5'- TACAAGCCAGCAGAATAGGTTC -3'
Posted On 2021-11-19