Incidental Mutation 'R9030:Vmn2r116'
ID 687023
Institutional Source Beutler Lab
Gene Symbol Vmn2r116
Ensembl Gene ENSMUSG00000090966
Gene Name vomeronasal 2, receptor 116
Synonyms V2Rp5, EG619697
MMRRC Submission 068859-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.060) question?
Stock # R9030 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 23603777-23620838 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 23603864 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 30 (K30E)
Ref Sequence ENSEMBL: ENSMUSP00000128106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164856]
AlphaFold E9Q6I0
Predicted Effect possibly damaging
Transcript: ENSMUST00000164856
AA Change: K30E

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000128106
Gene: ENSMUSG00000090966
AA Change: K30E

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 4.4e-30 PFAM
Pfam:NCD3G 511 564 1.2e-22 PFAM
low complexity region 589 594 N/A INTRINSIC
Pfam:7tm_3 595 832 8.7e-57 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (57/57)
MGI Phenotype PHENOTYPE: Female mice homozygous for a knock-out allele stimulated with male pheromone (Gm6084) fail to exhibit an increase in lordosis behavior and successful intromission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr5 A C 2: 158,474,321 (GRCm39) I375L probably benign Het
Adgrl2 G T 3: 148,544,761 (GRCm39) T778K possibly damaging Het
Ccn3 A T 15: 54,615,687 (GRCm39) Y284F probably damaging Het
Cdc73 A T 1: 143,485,234 (GRCm39) L478H probably damaging Het
Cdh20 C A 1: 110,027,843 (GRCm39) H529Q probably benign Het
Cep55 T C 19: 38,059,592 (GRCm39) probably null Het
Chd9 G A 8: 91,683,198 (GRCm39) R546Q unknown Het
Ddit4 A T 10: 59,786,515 (GRCm39) L178Q probably damaging Het
Dgke A T 11: 88,941,237 (GRCm39) N315K possibly damaging Het
Dsg1a A G 18: 20,473,549 (GRCm39) D874G probably damaging Het
Dsp T A 13: 38,352,673 (GRCm39) Y184N probably damaging Het
Dynlt1c A G 17: 6,870,916 (GRCm39) I20V probably benign Het
Ephx4 A G 5: 107,577,549 (GRCm39) H291R possibly damaging Het
Epx A T 11: 87,763,470 (GRCm39) M250K probably benign Het
Fan1 T C 7: 64,022,761 (GRCm39) Y164C probably benign Het
Fer1l6 A T 15: 58,502,594 (GRCm39) Y1365F probably damaging Het
Fndc8 A G 11: 82,789,522 (GRCm39) T227A probably benign Het
Gbp7 T C 3: 142,243,798 (GRCm39) I115T probably damaging Het
Gm5145 A G 17: 20,791,270 (GRCm39) E216G probably benign Het
Gm94 A T 18: 43,914,326 (GRCm39) F77L possibly damaging Het
Grik3 C A 4: 125,526,185 (GRCm39) H139Q probably benign Het
Gucy2e T C 11: 69,115,827 (GRCm39) T852A probably damaging Het
Hif1a T C 12: 73,983,010 (GRCm39) S274P probably damaging Het
Hmcn1 T A 1: 150,692,870 (GRCm39) I268L probably benign Het
Klk15 C T 7: 43,587,790 (GRCm39) H73Y possibly damaging Het
Lin52 T A 12: 84,592,681 (GRCm39) S87T Het
Lrrc74b A G 16: 17,367,640 (GRCm39) probably null Het
Mapk10 T C 5: 103,144,499 (GRCm39) K136R probably damaging Het
Nlrp2 A T 7: 5,325,457 (GRCm39) N738K probably null Het
Nlrp5 A T 7: 23,129,573 (GRCm39) Q880L possibly damaging Het
Or2y11 T A 11: 49,442,808 (GRCm39) V78E probably damaging Het
Or5d39 A T 2: 87,979,718 (GRCm39) I215N possibly damaging Het
Or6c215 G T 10: 129,637,926 (GRCm39) P156Q probably damaging Het
P4htm G A 9: 108,474,627 (GRCm39) P46L probably benign Het
Pcsk4 A T 10: 80,164,858 (GRCm39) H69Q probably damaging Het
Pdzd2 A G 15: 12,374,385 (GRCm39) S1917P probably benign Het
Pnpla5 A G 15: 83,998,087 (GRCm39) V385A possibly damaging Het
Prorp T C 12: 55,426,192 (GRCm39) F514S probably damaging Het
Rims2 C T 15: 39,339,873 (GRCm39) R856C probably damaging Het
Rprd2 A G 3: 95,691,622 (GRCm39) Y218H probably benign Het
Sat2 T A 11: 69,513,069 (GRCm39) probably benign Het
Sf1 C T 19: 6,426,336 (GRCm39) R186C Het
Snrnp200 A G 2: 127,053,466 (GRCm39) probably benign Het
Sqor A T 2: 122,629,514 (GRCm39) D124V probably benign Het
Ssh2 A G 11: 77,312,062 (GRCm39) H191R possibly damaging Het
Stac C A 9: 111,519,320 (GRCm39) probably benign Het
Svs4 T C 2: 164,119,058 (GRCm39) M93V unknown Het
Tbc1d32 A T 10: 56,037,241 (GRCm39) S668T possibly damaging Het
Tex10 A G 4: 48,452,056 (GRCm39) F690S probably damaging Het
Tex30 A G 1: 44,130,356 (GRCm39) M88T Het
Tgfbrap1 T C 1: 43,095,837 (GRCm39) T534A probably benign Het
Tmco1 C T 1: 167,136,132 (GRCm39) probably benign Het
Tnrc18 T C 5: 142,711,818 (GRCm39) E2647G probably damaging Het
Trim43a GATTTATTTATTTATTTATTTATTTATTTATTTATTTATT GATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATT 9: 88,465,042 (GRCm39) probably benign Het
Tubb3 A T 8: 124,145,696 (GRCm39) R62W probably damaging Het
Vmn2r108 A G 17: 20,690,312 (GRCm39) S507P probably benign Het
Vmn2r14 G A 5: 109,368,054 (GRCm39) H313Y probably damaging Het
Wdr37 C T 13: 8,885,424 (GRCm39) V340M probably damaging Het
Zfp799 A G 17: 33,039,565 (GRCm39) F234L possibly damaging Het
Other mutations in Vmn2r116
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Vmn2r116 APN 17 23,604,969 (GRCm39) missense possibly damaging 0.94
IGL00985:Vmn2r116 APN 17 23,620,489 (GRCm39) missense probably damaging 1.00
IGL00990:Vmn2r116 APN 17 23,606,210 (GRCm39) missense probably benign 0.12
IGL00990:Vmn2r116 APN 17 23,616,701 (GRCm39) missense probably damaging 1.00
IGL01383:Vmn2r116 APN 17 23,620,575 (GRCm39) missense probably damaging 1.00
IGL01459:Vmn2r116 APN 17 23,603,903 (GRCm39) missense probably damaging 1.00
IGL01725:Vmn2r116 APN 17 23,605,619 (GRCm39) missense probably damaging 1.00
IGL02125:Vmn2r116 APN 17 23,616,601 (GRCm39) splice site probably benign
IGL02170:Vmn2r116 APN 17 23,603,907 (GRCm39) missense probably benign
IGL02209:Vmn2r116 APN 17 23,607,761 (GRCm39) missense probably damaging 1.00
IGL02226:Vmn2r116 APN 17 23,603,808 (GRCm39) missense probably null
IGL02272:Vmn2r116 APN 17 23,604,978 (GRCm39) missense probably damaging 1.00
IGL02272:Vmn2r116 APN 17 23,604,973 (GRCm39) missense probably benign 0.06
IGL02403:Vmn2r116 APN 17 23,606,338 (GRCm39) missense probably damaging 1.00
IGL02686:Vmn2r116 APN 17 23,607,767 (GRCm39) missense probably damaging 0.99
IGL02750:Vmn2r116 APN 17 23,616,608 (GRCm39) splice site probably benign
IGL02977:Vmn2r116 APN 17 23,607,748 (GRCm39) missense possibly damaging 0.90
PIT4449001:Vmn2r116 UTSW 17 23,607,921 (GRCm39) missense probably benign 0.41
R0015:Vmn2r116 UTSW 17 23,620,823 (GRCm39) missense probably benign 0.03
R0219:Vmn2r116 UTSW 17 23,605,072 (GRCm39) nonsense probably null
R0281:Vmn2r116 UTSW 17 23,620,387 (GRCm39) missense possibly damaging 0.90
R0415:Vmn2r116 UTSW 17 23,606,253 (GRCm39) missense possibly damaging 0.55
R0592:Vmn2r116 UTSW 17 23,605,889 (GRCm39) missense probably damaging 0.99
R0610:Vmn2r116 UTSW 17 23,606,286 (GRCm39) missense probably damaging 1.00
R0635:Vmn2r116 UTSW 17 23,605,861 (GRCm39) missense possibly damaging 0.95
R0843:Vmn2r116 UTSW 17 23,619,934 (GRCm39) missense probably benign 0.01
R1329:Vmn2r116 UTSW 17 23,606,162 (GRCm39) missense possibly damaging 0.89
R1396:Vmn2r116 UTSW 17 23,605,115 (GRCm39) missense probably benign
R1401:Vmn2r116 UTSW 17 23,605,570 (GRCm39) splice site probably benign
R1574:Vmn2r116 UTSW 17 23,606,063 (GRCm39) missense probably damaging 0.99
R1574:Vmn2r116 UTSW 17 23,606,063 (GRCm39) missense probably damaging 0.99
R1766:Vmn2r116 UTSW 17 23,620,740 (GRCm39) missense probably damaging 0.98
R2157:Vmn2r116 UTSW 17 23,620,443 (GRCm39) missense probably damaging 1.00
R3622:Vmn2r116 UTSW 17 23,605,025 (GRCm39) missense probably benign 0.11
R3690:Vmn2r116 UTSW 17 23,603,798 (GRCm39) missense unknown
R4298:Vmn2r116 UTSW 17 23,620,801 (GRCm39) missense possibly damaging 0.69
R4373:Vmn2r116 UTSW 17 23,620,395 (GRCm39) missense probably benign 0.01
R4860:Vmn2r116 UTSW 17 23,620,777 (GRCm39) missense probably benign
R4941:Vmn2r116 UTSW 17 23,620,116 (GRCm39) missense probably damaging 1.00
R5119:Vmn2r116 UTSW 17 23,606,138 (GRCm39) missense probably benign 0.01
R5503:Vmn2r116 UTSW 17 23,605,778 (GRCm39) missense probably benign 0.07
R5510:Vmn2r116 UTSW 17 23,605,095 (GRCm39) missense probably damaging 1.00
R5538:Vmn2r116 UTSW 17 23,620,041 (GRCm39) missense probably benign 0.00
R5689:Vmn2r116 UTSW 17 23,616,693 (GRCm39) missense probably benign 0.30
R5765:Vmn2r116 UTSW 17 23,620,378 (GRCm39) missense probably damaging 0.99
R5794:Vmn2r116 UTSW 17 23,604,942 (GRCm39) missense probably damaging 0.99
R5807:Vmn2r116 UTSW 17 23,606,281 (GRCm39) missense probably damaging 1.00
R5837:Vmn2r116 UTSW 17 23,606,054 (GRCm39) missense probably damaging 1.00
R6262:Vmn2r116 UTSW 17 23,606,351 (GRCm39) missense probably benign 0.03
R6298:Vmn2r116 UTSW 17 23,605,736 (GRCm39) missense probably damaging 1.00
R6651:Vmn2r116 UTSW 17 23,607,805 (GRCm39) nonsense probably null
R6667:Vmn2r116 UTSW 17 23,620,066 (GRCm39) missense probably damaging 1.00
R7393:Vmn2r116 UTSW 17 23,605,099 (GRCm39) missense probably benign 0.14
R7571:Vmn2r116 UTSW 17 23,603,830 (GRCm39) splice site probably null
R7940:Vmn2r116 UTSW 17 23,605,946 (GRCm39) missense probably damaging 0.99
R8510:Vmn2r116 UTSW 17 23,604,905 (GRCm39) nonsense probably null
R8950:Vmn2r116 UTSW 17 23,620,467 (GRCm39) missense probably damaging 1.00
R8956:Vmn2r116 UTSW 17 23,605,736 (GRCm39) missense probably damaging 1.00
R8977:Vmn2r116 UTSW 17 23,605,916 (GRCm39) missense possibly damaging 0.56
R9077:Vmn2r116 UTSW 17 23,604,956 (GRCm39) missense probably benign 0.14
R9223:Vmn2r116 UTSW 17 23,620,141 (GRCm39) missense probably damaging 1.00
R9401:Vmn2r116 UTSW 17 23,620,566 (GRCm39) missense probably damaging 1.00
R9449:Vmn2r116 UTSW 17 23,605,919 (GRCm39) missense probably benign 0.01
R9746:Vmn2r116 UTSW 17 23,620,797 (GRCm39) missense probably benign 0.08
R9755:Vmn2r116 UTSW 17 23,620,065 (GRCm39) missense probably damaging 1.00
R9759:Vmn2r116 UTSW 17 23,620,360 (GRCm39) missense possibly damaging 0.90
R9800:Vmn2r116 UTSW 17 23,620,399 (GRCm39) missense probably damaging 0.97
S24628:Vmn2r116 UTSW 17 23,606,253 (GRCm39) missense possibly damaging 0.55
Z1176:Vmn2r116 UTSW 17 23,620,402 (GRCm39) missense probably damaging 1.00
Z1177:Vmn2r116 UTSW 17 23,607,866 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTGGGACACAGTGTTAATAGTG -3'
(R):5'- CCGTGCAAAAGCCTCATAGC -3'

Sequencing Primer
(F):5'- CACAGTGTTAATAGTGCATGGG -3'
(R):5'- AGCCTCATAGCTTTGCTTTGC -3'
Posted On 2021-11-19