Incidental Mutation 'R9030:Vmn2r116'
ID 687023
Institutional Source Beutler Lab
Gene Symbol Vmn2r116
Ensembl Gene ENSMUSG00000090966
Gene Name vomeronasal 2, receptor 116
Synonyms V2Rp5, EG619697
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock # R9030 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 23384803-23401864 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 23384890 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 30 (K30E)
Ref Sequence ENSEMBL: ENSMUSP00000128106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164856]
AlphaFold E9Q6I0
Predicted Effect possibly damaging
Transcript: ENSMUST00000164856
AA Change: K30E

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000128106
Gene: ENSMUSG00000090966
AA Change: K30E

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 4.4e-30 PFAM
Pfam:NCD3G 511 564 1.2e-22 PFAM
low complexity region 589 594 N/A INTRINSIC
Pfam:7tm_3 595 832 8.7e-57 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (57/57)
MGI Phenotype PHENOTYPE: Female mice homozygous for a knock-out allele stimulated with male pheromone (Gm6084) fail to exhibit an increase in lordosis behavior and successful intromission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik T C 12: 55,379,407 F514S probably damaging Het
Actr5 A C 2: 158,632,401 I375L probably benign Het
Adgrl2 G T 3: 148,839,125 T778K possibly damaging Het
Cdc73 A T 1: 143,609,496 L478H probably damaging Het
Cdh7 C A 1: 110,100,113 H529Q probably benign Het
Cep55 T C 19: 38,071,144 probably null Het
Chd9 G A 8: 90,956,570 R546Q unknown Het
Ddit4 A T 10: 59,950,693 L178Q probably damaging Het
Dgke A T 11: 89,050,411 N315K possibly damaging Het
Dsg1a A G 18: 20,340,492 D874G probably damaging Het
Dsp T A 13: 38,168,697 Y184N probably damaging Het
Dynlt1c A G 17: 6,603,517 I20V probably benign Het
Ephx4 A G 5: 107,429,683 H291R possibly damaging Het
Epx A T 11: 87,872,644 M250K probably benign Het
Fan1 T C 7: 64,373,013 Y164C probably benign Het
Fer1l6 A T 15: 58,630,745 Y1365F probably damaging Het
Fndc8 A G 11: 82,898,696 T227A probably benign Het
Gbp7 T C 3: 142,538,037 I115T probably damaging Het
Gm5145 A G 17: 20,571,008 E216G probably benign Het
Gm94 A T 18: 43,781,261 F77L possibly damaging Het
Grik3 C A 4: 125,632,392 H139Q probably benign Het
Gucy2e T C 11: 69,225,001 T852A probably damaging Het
Hif1a T C 12: 73,936,236 S274P probably damaging Het
Hmcn1 T A 1: 150,817,119 I268L probably benign Het
Klk15 C T 7: 43,938,366 H73Y possibly damaging Het
Lin52 T A 12: 84,545,907 S87T Het
Lrrc74b A G 16: 17,549,776 probably null Het
Mapk10 T C 5: 102,996,633 K136R probably damaging Het
Nlrp2 A T 7: 5,322,458 N738K probably null Het
Nlrp5 A T 7: 23,430,148 Q880L possibly damaging Het
Nov A T 15: 54,752,291 Y284F probably damaging Het
Olfr1167 A T 2: 88,149,374 I215N possibly damaging Het
Olfr1381 T A 11: 49,551,981 V78E probably damaging Het
Olfr811 G T 10: 129,802,057 P156Q probably damaging Het
P4htm G A 9: 108,597,428 P46L probably benign Het
Pcsk4 A T 10: 80,329,024 H69Q probably damaging Het
Pdzd2 A G 15: 12,374,299 S1917P probably benign Het
Pnpla5 A G 15: 84,113,886 V385A possibly damaging Het
Rims2 C T 15: 39,476,477 R856C probably damaging Het
Rprd2 A G 3: 95,784,310 Y218H probably benign Het
Sat2 T A 11: 69,622,243 probably benign Het
Sf1 C T 19: 6,376,306 R186C Het
Snrnp200 A G 2: 127,211,546 probably benign Het
Sqor A T 2: 122,787,594 D124V probably benign Het
Ssh2 A G 11: 77,421,236 H191R possibly damaging Het
Stac C A 9: 111,690,252 probably benign Het
Svs4 T C 2: 164,277,138 M93V unknown Het
Tbc1d32 A T 10: 56,161,145 S668T possibly damaging Het
Tex10 A G 4: 48,452,056 F690S probably damaging Het
Tex30 A G 1: 44,091,196 M88T Het
Tgfbrap1 T C 1: 43,056,677 T534A probably benign Het
Tmco1 C T 1: 167,308,563 probably benign Het
Tnrc18 T C 5: 142,726,063 E2647G probably damaging Het
Trim43a GATTTATTTATTTATTTATTTATTTATTTATTTATTTATT GATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATT 9: 88,582,989 probably benign Het
Tubb3 A T 8: 123,418,957 R62W probably damaging Het
Vmn2r108 A G 17: 20,470,050 S507P probably benign Het
Vmn2r14 G A 5: 109,220,188 H313Y probably damaging Het
Wdr37 C T 13: 8,835,388 V340M probably damaging Het
Zfp799 A G 17: 32,820,591 F234L possibly damaging Het
Other mutations in Vmn2r116
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Vmn2r116 APN 17 23385995 missense possibly damaging 0.94
IGL00985:Vmn2r116 APN 17 23401515 missense probably damaging 1.00
IGL00990:Vmn2r116 APN 17 23397727 missense probably damaging 1.00
IGL00990:Vmn2r116 APN 17 23387236 missense probably benign 0.12
IGL01383:Vmn2r116 APN 17 23401601 missense probably damaging 1.00
IGL01459:Vmn2r116 APN 17 23384929 missense probably damaging 1.00
IGL01725:Vmn2r116 APN 17 23386645 missense probably damaging 1.00
IGL02125:Vmn2r116 APN 17 23397627 splice site probably benign
IGL02170:Vmn2r116 APN 17 23384933 missense probably benign
IGL02209:Vmn2r116 APN 17 23388787 missense probably damaging 1.00
IGL02226:Vmn2r116 APN 17 23384834 missense probably null
IGL02272:Vmn2r116 APN 17 23385999 missense probably benign 0.06
IGL02272:Vmn2r116 APN 17 23386004 missense probably damaging 1.00
IGL02403:Vmn2r116 APN 17 23387364 missense probably damaging 1.00
IGL02686:Vmn2r116 APN 17 23388793 missense probably damaging 0.99
IGL02750:Vmn2r116 APN 17 23397634 splice site probably benign
IGL02977:Vmn2r116 APN 17 23388774 missense possibly damaging 0.90
PIT4449001:Vmn2r116 UTSW 17 23388947 missense probably benign 0.41
R0015:Vmn2r116 UTSW 17 23401849 missense probably benign 0.03
R0219:Vmn2r116 UTSW 17 23386098 nonsense probably null
R0281:Vmn2r116 UTSW 17 23401413 missense possibly damaging 0.90
R0415:Vmn2r116 UTSW 17 23387279 missense possibly damaging 0.55
R0592:Vmn2r116 UTSW 17 23386915 missense probably damaging 0.99
R0610:Vmn2r116 UTSW 17 23387312 missense probably damaging 1.00
R0635:Vmn2r116 UTSW 17 23386887 missense possibly damaging 0.95
R0843:Vmn2r116 UTSW 17 23400960 missense probably benign 0.01
R1329:Vmn2r116 UTSW 17 23387188 missense possibly damaging 0.89
R1396:Vmn2r116 UTSW 17 23386141 missense probably benign
R1401:Vmn2r116 UTSW 17 23386596 splice site probably benign
R1574:Vmn2r116 UTSW 17 23387089 missense probably damaging 0.99
R1574:Vmn2r116 UTSW 17 23387089 missense probably damaging 0.99
R1766:Vmn2r116 UTSW 17 23401766 missense probably damaging 0.98
R2157:Vmn2r116 UTSW 17 23401469 missense probably damaging 1.00
R3622:Vmn2r116 UTSW 17 23386051 missense probably benign 0.11
R3690:Vmn2r116 UTSW 17 23384824 missense unknown
R4298:Vmn2r116 UTSW 17 23401827 missense possibly damaging 0.69
R4373:Vmn2r116 UTSW 17 23401421 missense probably benign 0.01
R4860:Vmn2r116 UTSW 17 23401803 missense probably benign
R4941:Vmn2r116 UTSW 17 23401142 missense probably damaging 1.00
R5119:Vmn2r116 UTSW 17 23387164 missense probably benign 0.01
R5503:Vmn2r116 UTSW 17 23386804 missense probably benign 0.07
R5510:Vmn2r116 UTSW 17 23386121 missense probably damaging 1.00
R5538:Vmn2r116 UTSW 17 23401067 missense probably benign 0.00
R5689:Vmn2r116 UTSW 17 23397719 missense probably benign 0.30
R5765:Vmn2r116 UTSW 17 23401404 missense probably damaging 0.99
R5794:Vmn2r116 UTSW 17 23385968 missense probably damaging 0.99
R5807:Vmn2r116 UTSW 17 23387307 missense probably damaging 1.00
R5837:Vmn2r116 UTSW 17 23387080 missense probably damaging 1.00
R6262:Vmn2r116 UTSW 17 23387377 missense probably benign 0.03
R6298:Vmn2r116 UTSW 17 23386762 missense probably damaging 1.00
R6651:Vmn2r116 UTSW 17 23388831 nonsense probably null
R6667:Vmn2r116 UTSW 17 23401092 missense probably damaging 1.00
R7393:Vmn2r116 UTSW 17 23386125 missense probably benign 0.14
R7571:Vmn2r116 UTSW 17 23384856 splice site probably null
R7940:Vmn2r116 UTSW 17 23386972 missense probably damaging 0.99
R8510:Vmn2r116 UTSW 17 23385931 nonsense probably null
R8950:Vmn2r116 UTSW 17 23401493 missense probably damaging 1.00
R8956:Vmn2r116 UTSW 17 23386762 missense probably damaging 1.00
R8977:Vmn2r116 UTSW 17 23386942 missense possibly damaging 0.56
R9077:Vmn2r116 UTSW 17 23385982 missense probably benign 0.14
R9223:Vmn2r116 UTSW 17 23401167 missense probably damaging 1.00
R9401:Vmn2r116 UTSW 17 23401592 missense probably damaging 1.00
R9449:Vmn2r116 UTSW 17 23386945 missense probably benign 0.01
R9746:Vmn2r116 UTSW 17 23401823 missense probably benign 0.08
R9755:Vmn2r116 UTSW 17 23401091 missense probably damaging 1.00
R9759:Vmn2r116 UTSW 17 23401386 missense possibly damaging 0.90
R9800:Vmn2r116 UTSW 17 23401425 missense probably damaging 0.97
S24628:Vmn2r116 UTSW 17 23387279 missense possibly damaging 0.55
Z1176:Vmn2r116 UTSW 17 23401428 missense probably damaging 1.00
Z1177:Vmn2r116 UTSW 17 23388892 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTGGGACACAGTGTTAATAGTG -3'
(R):5'- CCGTGCAAAAGCCTCATAGC -3'

Sequencing Primer
(F):5'- CACAGTGTTAATAGTGCATGGG -3'
(R):5'- AGCCTCATAGCTTTGCTTTGC -3'
Posted On 2021-11-19