Incidental Mutation 'R9031:Myo3b'
ID 687032
Institutional Source Beutler Lab
Gene Symbol Myo3b
Ensembl Gene ENSMUSG00000042064
Gene Name myosin IIIB
Synonyms A430065P19Rik
MMRRC Submission 068860-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9031 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 69869470-70259542 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 70082094 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 618 (V618A)
Ref Sequence ENSEMBL: ENSMUSP00000055362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060208] [ENSMUST00000112243]
AlphaFold Q1EG27
Predicted Effect probably damaging
Transcript: ENSMUST00000060208
AA Change: V618A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000055362
Gene: ENSMUSG00000042064
AA Change: V618A

DomainStartEndE-ValueType
S_TKc 43 309 2.24e-85 SMART
MYSc 353 1075 6.61e-260 SMART
IQ 1075 1097 9.51e1 SMART
IQ 1102 1124 1.73e-5 SMART
low complexity region 1319 1324 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112243
AA Change: V590A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107862
Gene: ENSMUSG00000042064
AA Change: V590A

DomainStartEndE-ValueType
S_TKc 15 281 2.24e-85 SMART
MYSc 325 1047 6.61e-260 SMART
IQ 1047 1069 9.51e1 SMART
IQ 1074 1096 1.73e-5 SMART
low complexity region 1291 1296 N/A INTRINSIC
Meta Mutation Damage Score 0.7268 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (81/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the class III myosins. Myosins are ATPases, activated by actin, that move along actin filaments in the cell. This class of myosins are characterized by an amino-terminal kinase domain and shown to be present in photoreceptors. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 G A 19: 43,810,466 (GRCm39) R921H probably benign Het
Adcy5 A G 16: 35,119,859 (GRCm39) I1123V probably damaging Het
Agr2 G C 12: 36,045,565 (GRCm39) G17A probably benign Het
Akap6 A T 12: 53,188,831 (GRCm39) T2082S probably benign Het
Asxl3 G T 18: 22,657,401 (GRCm39) V1804F probably damaging Het
Atat1 A G 17: 36,220,381 (GRCm39) V37A probably benign Het
Atp1a3 A T 7: 24,689,212 (GRCm39) probably null Het
Bpifb1 A G 2: 154,051,848 (GRCm39) T218A probably benign Het
C030006K11Rik T A 15: 76,607,961 (GRCm39) Q19L probably benign Het
Ccdc138 T C 10: 58,380,893 (GRCm39) F508S probably damaging Het
Ccdc81 T A 7: 89,542,358 (GRCm39) M173L probably benign Het
Cdhr1 T C 14: 36,815,976 (GRCm39) I141V probably benign Het
Chia1 T C 3: 106,035,777 (GRCm39) F206L probably benign Het
Clca3a2 C T 3: 144,511,475 (GRCm39) G640E probably damaging Het
Clcn7 T C 17: 25,376,497 (GRCm39) V609A probably damaging Het
Cmklr2 T C 1: 63,223,145 (GRCm39) E30G probably benign Het
Col22a1 C A 15: 71,753,523 (GRCm39) G126* probably null Het
Cpne7 C T 8: 123,856,951 (GRCm39) P402L probably damaging Het
Ctcfl A T 2: 172,959,044 (GRCm39) D227E probably benign Het
Cwf19l2 A G 9: 3,417,942 (GRCm39) D134G probably benign Het
Cyp2c65 C A 19: 39,061,663 (GRCm39) C216* probably null Het
Cyp2d12 T A 15: 82,443,423 (GRCm39) C462S probably null Het
Cyp4a12a A C 4: 115,189,199 (GRCm39) *509Y probably null Het
Cyp4a12b A G 4: 115,290,865 (GRCm39) M298V probably benign Het
Dennd4b T C 3: 90,178,188 (GRCm39) V471A probably benign Het
Dlc1 A G 8: 37,405,055 (GRCm39) S245P possibly damaging Het
Dnah1 C T 14: 31,001,128 (GRCm39) G2406S probably benign Het
Dnah8 A G 17: 30,956,401 (GRCm39) K2127R probably damaging Het
Dusp13b G A 14: 21,790,233 (GRCm39) R38C probably benign Het
Ebf2 T A 14: 67,472,594 (GRCm39) I4N probably benign Het
Eef1ece2 C T 16: 20,459,375 (GRCm39) P570L probably damaging Het
Fcgbp A G 7: 27,790,908 (GRCm39) N723S possibly damaging Het
Galnt15 T A 14: 31,770,027 (GRCm39) V368E probably damaging Het
Garem2 A G 5: 30,313,262 (GRCm39) E42G possibly damaging Het
Gcc1 C T 6: 28,418,182 (GRCm39) S717N probably damaging Het
Gfm2 T C 13: 97,309,201 (GRCm39) probably null Het
Helb T C 10: 119,920,790 (GRCm39) D1051G possibly damaging Het
Helz2 T A 2: 180,874,261 (GRCm39) I2078F possibly damaging Het
Hsph1 A T 5: 149,553,270 (GRCm39) V297D probably damaging Het
Ifnar1 A G 16: 91,302,079 (GRCm39) Y518C probably benign Het
Kcnip2 T A 19: 45,783,210 (GRCm39) D153V probably damaging Het
Kif15 A T 9: 122,846,492 (GRCm39) probably benign Het
Kif21b T C 1: 136,073,042 (GRCm39) F147L probably damaging Het
Klhl29 T C 12: 5,140,537 (GRCm39) R702G probably damaging Het
Lemd3 C T 10: 120,767,878 (GRCm39) E667K possibly damaging Het
Loxl3 T C 6: 83,012,503 (GRCm39) L14P probably damaging Het
Lrrd1 A T 5: 3,900,963 (GRCm39) K423* probably null Het
Mia2 A G 12: 59,155,586 (GRCm39) D433G probably damaging Het
Mpp2 G T 11: 101,954,099 (GRCm39) A216E probably benign Het
Mro T C 18: 74,009,911 (GRCm39) probably null Het
Mybpc1 T G 10: 88,358,906 (GRCm39) Y1081S probably damaging Het
Myh8 T G 11: 67,190,141 (GRCm39) S1260R possibly damaging Het
Naip2 T G 13: 100,314,776 (GRCm39) D334A possibly damaging Het
Naip5 T A 13: 100,356,338 (GRCm39) E1092D probably benign Het
Nlrp4c T C 7: 6,107,608 (GRCm39) *983Q probably null Het
Nlrp9a T G 7: 26,257,698 (GRCm39) F439V probably damaging Het
Nploc4 A T 11: 120,319,368 (GRCm39) L64H probably damaging Het
Ola1 T C 2: 72,924,060 (GRCm39) E246G probably benign Het
Otof G A 5: 30,537,532 (GRCm39) S1259F probably benign Het
Pde4dip T C 3: 97,599,675 (GRCm39) T2438A probably damaging Het
Pex1 A G 5: 3,686,844 (GRCm39) T1242A probably damaging Het
Pink1 A T 4: 138,043,056 (GRCm39) probably benign Het
Prkcq A G 2: 11,251,819 (GRCm39) T219A probably damaging Het
Ptcd3 A T 6: 71,880,458 (GRCm39) Y88* probably null Het
Ptpru A G 4: 131,515,691 (GRCm39) Y888H probably damaging Het
Rapgef6 A G 11: 54,578,667 (GRCm39) N1063S probably benign Het
Slc1a4 G A 11: 20,282,532 (GRCm39) probably benign Het
Slc4a4 T C 5: 89,205,568 (GRCm39) probably benign Het
Slc6a18 A T 13: 73,819,822 (GRCm39) N249K possibly damaging Het
Slco2b1 T G 7: 99,338,214 (GRCm39) I104L probably damaging Het
Syne3 A T 12: 104,905,871 (GRCm39) S897R probably benign Het
Tlcd5 C T 9: 43,022,664 (GRCm39) R230Q probably benign Het
Tnni3k A G 3: 154,744,146 (GRCm39) S69P probably damaging Het
Tnpo2 A G 8: 85,780,163 (GRCm39) K700E probably benign Het
Top3a T C 11: 60,636,695 (GRCm39) K657E probably damaging Het
Trgv4 C T 13: 19,369,169 (GRCm39) Q7* probably null Het
Trim6 T C 7: 103,875,159 (GRCm39) L132P probably damaging Het
Tshz1 T C 18: 84,032,987 (GRCm39) T474A probably benign Het
Unc13d AATGCCTCCCATGCC AATGCCTCCCATGCCTCCCATGCC 11: 115,958,998 (GRCm39) probably benign Het
Vmn1r179 A T 7: 23,628,234 (GRCm39) I142L probably benign Het
Zbtb2 A T 10: 4,319,183 (GRCm39) F281Y probably damaging Het
Zfp318 T C 17: 46,723,433 (GRCm39) V1812A probably benign Het
Other mutations in Myo3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00736:Myo3b APN 2 69,935,989 (GRCm39) splice site probably benign
IGL00959:Myo3b APN 2 70,144,636 (GRCm39) missense probably damaging 1.00
IGL01069:Myo3b APN 2 70,075,735 (GRCm39) missense probably benign 0.22
IGL01116:Myo3b APN 2 70,119,730 (GRCm39) missense probably damaging 1.00
IGL02097:Myo3b APN 2 70,069,173 (GRCm39) missense probably damaging 1.00
IGL02220:Myo3b APN 2 70,119,923 (GRCm39) splice site probably benign
IGL02553:Myo3b APN 2 69,925,568 (GRCm39) missense probably benign 0.00
IGL02557:Myo3b APN 2 70,085,663 (GRCm39) missense probably benign 0.16
IGL02648:Myo3b APN 2 69,935,716 (GRCm39) splice site probably benign
IGL02902:Myo3b APN 2 70,119,745 (GRCm39) missense probably benign 0.36
IGL02981:Myo3b APN 2 69,938,969 (GRCm39) missense probably damaging 1.00
IGL03030:Myo3b APN 2 70,257,160 (GRCm39) splice site probably benign
IGL03031:Myo3b APN 2 70,085,721 (GRCm39) missense possibly damaging 0.64
IGL03068:Myo3b APN 2 70,257,160 (GRCm39) splice site probably benign
IGL03078:Myo3b APN 2 70,117,335 (GRCm39) missense probably damaging 1.00
IGL03224:Myo3b APN 2 70,180,283 (GRCm39) missense probably benign
IGL03329:Myo3b APN 2 70,084,803 (GRCm39) missense probably damaging 1.00
R0079:Myo3b UTSW 2 69,925,502 (GRCm39) missense possibly damaging 0.58
R0226:Myo3b UTSW 2 70,047,510 (GRCm39) missense probably benign 0.00
R0238:Myo3b UTSW 2 69,935,769 (GRCm39) missense probably benign 0.00
R0238:Myo3b UTSW 2 69,935,769 (GRCm39) missense probably benign 0.00
R0239:Myo3b UTSW 2 69,935,769 (GRCm39) missense probably benign 0.00
R0239:Myo3b UTSW 2 69,935,769 (GRCm39) missense probably benign 0.00
R0313:Myo3b UTSW 2 70,179,303 (GRCm39) nonsense probably null
R0331:Myo3b UTSW 2 69,925,605 (GRCm39) missense probably damaging 1.00
R0371:Myo3b UTSW 2 70,083,304 (GRCm39) splice site probably benign
R0442:Myo3b UTSW 2 70,069,305 (GRCm39) critical splice donor site probably null
R0964:Myo3b UTSW 2 70,257,193 (GRCm39) missense probably damaging 1.00
R1217:Myo3b UTSW 2 70,161,224 (GRCm39) missense probably benign 0.02
R1429:Myo3b UTSW 2 70,083,351 (GRCm39) missense probably damaging 0.97
R1460:Myo3b UTSW 2 70,062,798 (GRCm39) missense probably benign 0.31
R1617:Myo3b UTSW 2 70,111,562 (GRCm39) missense probably benign 0.00
R1628:Myo3b UTSW 2 70,117,306 (GRCm39) missense probably benign 0.01
R1708:Myo3b UTSW 2 70,075,729 (GRCm39) nonsense probably null
R1940:Myo3b UTSW 2 70,088,419 (GRCm39) missense probably benign 0.01
R2407:Myo3b UTSW 2 70,085,597 (GRCm39) missense probably damaging 1.00
R3081:Myo3b UTSW 2 70,086,927 (GRCm39) splice site probably benign
R3687:Myo3b UTSW 2 70,075,658 (GRCm39) missense probably benign
R3745:Myo3b UTSW 2 70,064,829 (GRCm39) splice site probably benign
R4011:Myo3b UTSW 2 69,926,720 (GRCm39) missense probably benign 0.15
R4074:Myo3b UTSW 2 70,119,808 (GRCm39) missense probably damaging 1.00
R4419:Myo3b UTSW 2 69,926,706 (GRCm39) missense probably damaging 1.00
R4496:Myo3b UTSW 2 70,084,748 (GRCm39) missense probably benign
R4539:Myo3b UTSW 2 69,869,491 (GRCm39) start codon destroyed probably null 0.00
R4643:Myo3b UTSW 2 70,069,186 (GRCm39) missense possibly damaging 0.49
R4657:Myo3b UTSW 2 70,069,243 (GRCm39) missense possibly damaging 0.95
R4807:Myo3b UTSW 2 69,936,056 (GRCm39) missense probably damaging 1.00
R4849:Myo3b UTSW 2 70,075,253 (GRCm39) missense probably damaging 0.98
R4997:Myo3b UTSW 2 70,088,427 (GRCm39) missense possibly damaging 0.49
R5008:Myo3b UTSW 2 70,088,412 (GRCm39) missense probably damaging 0.99
R5070:Myo3b UTSW 2 70,083,456 (GRCm39) missense probably damaging 1.00
R5072:Myo3b UTSW 2 69,925,593 (GRCm39) missense possibly damaging 0.96
R5082:Myo3b UTSW 2 70,088,374 (GRCm39) missense probably benign 0.01
R5103:Myo3b UTSW 2 69,926,747 (GRCm39) missense probably benign 0.08
R5109:Myo3b UTSW 2 69,925,637 (GRCm39) missense possibly damaging 0.66
R5304:Myo3b UTSW 2 70,257,232 (GRCm39) missense probably damaging 0.97
R5396:Myo3b UTSW 2 69,957,329 (GRCm39) missense probably damaging 0.99
R5400:Myo3b UTSW 2 69,935,724 (GRCm39) missense probably damaging 1.00
R5468:Myo3b UTSW 2 70,064,785 (GRCm39) missense probably benign 0.00
R5620:Myo3b UTSW 2 70,069,254 (GRCm39) missense probably benign 0.04
R5646:Myo3b UTSW 2 70,144,774 (GRCm39) missense probably damaging 0.97
R5729:Myo3b UTSW 2 69,936,083 (GRCm39) missense probably damaging 1.00
R5943:Myo3b UTSW 2 70,117,285 (GRCm39) missense probably benign 0.03
R5971:Myo3b UTSW 2 70,069,243 (GRCm39) missense possibly damaging 0.95
R6091:Myo3b UTSW 2 70,069,113 (GRCm39) missense probably benign 0.00
R6138:Myo3b UTSW 2 70,069,243 (GRCm39) missense possibly damaging 0.95
R6164:Myo3b UTSW 2 70,075,754 (GRCm39) critical splice donor site probably null
R6177:Myo3b UTSW 2 70,143,707 (GRCm39) missense probably benign 0.00
R6421:Myo3b UTSW 2 70,143,700 (GRCm39) missense probably benign 0.02
R6478:Myo3b UTSW 2 70,179,304 (GRCm39) missense probably benign
R6606:Myo3b UTSW 2 70,062,829 (GRCm39) missense possibly damaging 0.94
R6752:Myo3b UTSW 2 70,119,856 (GRCm39) missense probably damaging 1.00
R6982:Myo3b UTSW 2 70,256,409 (GRCm39) missense probably benign 0.02
R6997:Myo3b UTSW 2 69,957,329 (GRCm39) missense probably damaging 0.99
R7032:Myo3b UTSW 2 69,925,608 (GRCm39) missense probably damaging 0.98
R7038:Myo3b UTSW 2 69,925,552 (GRCm39) missense probably benign 0.00
R7062:Myo3b UTSW 2 70,047,501 (GRCm39) missense probably benign 0.00
R7537:Myo3b UTSW 2 70,047,513 (GRCm39) missense probably benign 0.01
R7861:Myo3b UTSW 2 69,939,032 (GRCm39) missense probably damaging 1.00
R7955:Myo3b UTSW 2 69,925,623 (GRCm39) missense probably benign 0.37
R7977:Myo3b UTSW 2 70,161,277 (GRCm39) missense probably benign
R7978:Myo3b UTSW 2 70,083,458 (GRCm39) missense probably damaging 1.00
R7987:Myo3b UTSW 2 70,161,277 (GRCm39) missense probably benign
R8803:Myo3b UTSW 2 70,083,338 (GRCm39) missense probably benign
R8843:Myo3b UTSW 2 70,088,325 (GRCm39) missense probably damaging 1.00
R8896:Myo3b UTSW 2 70,069,160 (GRCm39) missense probably damaging 1.00
R8904:Myo3b UTSW 2 70,257,252 (GRCm39) missense probably benign 0.07
R8909:Myo3b UTSW 2 70,083,440 (GRCm39) missense probably damaging 1.00
R9052:Myo3b UTSW 2 70,062,747 (GRCm39) missense probably benign 0.00
R9251:Myo3b UTSW 2 70,088,425 (GRCm39) nonsense probably null
R9268:Myo3b UTSW 2 70,257,305 (GRCm39) makesense probably null
R9334:Myo3b UTSW 2 70,047,360 (GRCm39) missense probably damaging 1.00
R9377:Myo3b UTSW 2 70,069,242 (GRCm39) missense possibly damaging 0.78
R9457:Myo3b UTSW 2 69,925,553 (GRCm39) missense probably benign 0.01
R9520:Myo3b UTSW 2 70,062,753 (GRCm39) missense possibly damaging 0.67
R9593:Myo3b UTSW 2 70,075,648 (GRCm39) missense probably benign 0.43
R9671:Myo3b UTSW 2 70,086,908 (GRCm39) missense probably damaging 1.00
R9790:Myo3b UTSW 2 70,180,287 (GRCm39) missense probably benign 0.35
R9791:Myo3b UTSW 2 70,180,287 (GRCm39) missense probably benign 0.35
U15987:Myo3b UTSW 2 70,069,243 (GRCm39) missense possibly damaging 0.95
X0025:Myo3b UTSW 2 70,062,747 (GRCm39) missense probably benign 0.00
X0065:Myo3b UTSW 2 70,088,313 (GRCm39) missense probably damaging 1.00
Z1177:Myo3b UTSW 2 70,088,371 (GRCm39) missense probably benign 0.01
Z1177:Myo3b UTSW 2 69,926,705 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCTTAGTGACATCATCGCC -3'
(R):5'- GAAGATGAGTTACAGCTGCACC -3'

Sequencing Primer
(F):5'- TCATCGCCTCTAACTTCAGGAAG -3'
(R):5'- GATGAGTTACAGCTGCACCGTATC -3'
Posted On 2021-11-19