Incidental Mutation 'R9032:Emc1'
ID 687125
Institutional Source Beutler Lab
Gene Symbol Emc1
Ensembl Gene ENSMUSG00000078517
Gene Name ER membrane protein complex subunit 1
Synonyms C230096C10Rik
MMRRC Submission 068861-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.964) question?
Stock # R9032 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 139079898-139106041 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 139094474 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 676 (Y676H)
Ref Sequence ENSEMBL: ENSMUSP00000137103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042096] [ENSMUST00000082262] [ENSMUST00000147999] [ENSMUST00000155700] [ENSMUST00000179784]
AlphaFold Q8C7X2
Predicted Effect possibly damaging
Transcript: ENSMUST00000042096
AA Change: Y673H

PolyPhen 2 Score 0.619 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000049034
Gene: ENSMUSG00000078517
AA Change: Y673H

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 5.3e-9 PFAM
Pfam:DUF1620 787 993 1.1e-66 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000082262
AA Change: Y676H

PolyPhen 2 Score 0.826 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000080888
Gene: ENSMUSG00000078517
AA Change: Y676H

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 4.7e-10 PFAM
Pfam:DUF1620 791 996 1.1e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147999
SMART Domains Protein: ENSMUSP00000117419
Gene: ENSMUSG00000066036

DomainStartEndE-ValueType
low complexity region 170 226 N/A INTRINSIC
low complexity region 617 629 N/A INTRINSIC
Pfam:E3_UbLigase_R4 1205 1301 4.5e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155700
Predicted Effect possibly damaging
Transcript: ENSMUST00000179784
AA Change: Y676H

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000137103
Gene: ENSMUSG00000078517
AA Change: Y676H

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 5.3e-9 PFAM
Pfam:DUF1620 790 996 1.1e-66 PFAM
Meta Mutation Damage Score 0.8014 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type I transmembrane protein, which is a subunit of the endoplasmic reticulum membrane protein complex (EMC). Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2012]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik C T 15: 84,844,782 (GRCm39) M78I probably benign Het
Abca8b C T 11: 109,848,073 (GRCm39) V803M probably benign Het
Acap1 T C 11: 69,772,491 (GRCm39) E728G probably damaging Het
Afg1l G A 10: 42,194,637 (GRCm39) T385M probably damaging Het
Ankib1 T C 5: 3,819,641 (GRCm39) I93V probably benign Het
Aopep C T 13: 63,444,681 (GRCm39) R752* probably null Het
Apoa4 T A 9: 46,154,275 (GRCm39) L292Q probably damaging Het
Arhgap29 T A 3: 121,808,249 (GRCm39) D1142E probably benign Het
Asb5 A T 8: 55,038,929 (GRCm39) D265V probably benign Het
Ash1l C T 3: 88,889,294 (GRCm39) A391V probably benign Het
Ash1l T C 3: 88,891,529 (GRCm39) V1136A probably benign Het
Cacna1c G T 6: 118,615,466 (GRCm39) Y1308* probably null Het
Ctif CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC 18: 75,604,874 (GRCm39) probably benign Het
Dmtn A G 14: 70,853,534 (GRCm39) S92P probably damaging Het
Edc4 T C 8: 106,613,639 (GRCm39) F353S probably damaging Het
Epb41l4b A T 4: 57,041,064 (GRCm39) probably null Het
Fat1 A T 8: 45,492,894 (GRCm39) N3872I probably benign Het
Fer T A 17: 64,228,767 (GRCm39) M214K probably damaging Het
Fgf17 A G 14: 70,874,436 (GRCm39) F129L probably damaging Het
Fnbp1 T C 2: 30,973,017 (GRCm39) D161G probably damaging Het
Frmd4b A C 6: 97,269,334 (GRCm39) S993A probably benign Het
Hsh2d T C 8: 72,954,385 (GRCm39) S256P probably benign Het
Il31ra T C 13: 112,660,628 (GRCm39) S654G Het
Lmnb2 T C 10: 80,740,091 (GRCm39) D442G probably benign Het
Med19 A G 2: 84,515,660 (GRCm39) M115V probably damaging Het
Mroh5 T C 15: 73,655,302 (GRCm39) Y641C probably benign Het
Mrpl18 A T 17: 13,134,582 (GRCm39) V61E probably damaging Het
Mrtfb A C 16: 13,230,092 (GRCm39) T926P probably damaging Het
Mtap AC A 4: 89,090,515 (GRCm39) probably null Het
Muc2 T A 7: 141,287,058 (GRCm39) C154S probably damaging Het
Mypn T G 10: 62,983,894 (GRCm39) probably null Het
Naip5 T A 13: 100,356,338 (GRCm39) E1092D probably benign Het
Nes T G 3: 87,887,069 (GRCm39) V1776G possibly damaging Het
Nxn A G 11: 76,169,383 (GRCm39) I132T probably damaging Het
Oxr1 G A 15: 41,718,317 (GRCm39) V798I probably benign Het
Papss1 C A 3: 131,324,817 (GRCm39) H425N probably damaging Het
Pde4dip T C 3: 97,601,385 (GRCm39) N2344S probably benign Het
Pfas C T 11: 68,879,421 (GRCm39) G263S Het
Pknox1 C T 17: 31,822,229 (GRCm39) T332M possibly damaging Het
Plch2 T C 4: 155,084,976 (GRCm39) D321G probably damaging Het
Pnma1 T C 12: 84,193,806 (GRCm39) N299S probably benign Het
Psg23 T G 7: 18,348,660 (GRCm39) N49T possibly damaging Het
Qrfpr A G 3: 36,276,099 (GRCm39) F97S probably damaging Het
Rbl1 A G 2: 157,035,073 (GRCm39) F336L probably benign Het
Rpap1 G A 2: 119,608,776 (GRCm39) P143S probably benign Het
Rsph6a A T 7: 18,799,250 (GRCm39) N294Y probably damaging Het
Serpinb9h T C 13: 33,581,781 (GRCm39) Y113H probably damaging Het
Sesn1 C T 10: 41,686,835 (GRCm39) probably benign Het
Sh3d19 T C 3: 86,033,992 (GRCm39) Y782H probably damaging Het
Siglecg T C 7: 43,061,049 (GRCm39) V374A probably benign Het
Slc35d2 A G 13: 64,256,227 (GRCm39) F156S probably damaging Het
Slc6a11 A T 6: 114,202,808 (GRCm39) I301F probably damaging Het
Slx4ip A G 2: 136,910,240 (GRCm39) K412E possibly damaging Het
Tas2r115 A T 6: 132,714,327 (GRCm39) V208E probably benign Het
Tlcd5 C T 9: 43,022,664 (GRCm39) R230Q probably benign Het
Tmem132a G T 19: 10,843,835 (GRCm39) Q174K probably damaging Het
Tmtc1 A T 6: 148,237,749 (GRCm39) Y338* probably null Het
Vav3 C T 3: 109,413,722 (GRCm39) A220V probably benign Het
Wt1 C A 2: 104,957,160 (GRCm39) Q7K probably benign Het
Zbtb4 T A 11: 69,672,650 (GRCm39) F204L probably benign Het
Zfp51 T A 17: 21,684,660 (GRCm39) L425H probably damaging Het
Other mutations in Emc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Emc1 APN 4 139,082,393 (GRCm39) splice site probably benign
IGL00898:Emc1 APN 4 139,098,941 (GRCm39) missense probably damaging 1.00
IGL01481:Emc1 APN 4 139,089,410 (GRCm39) missense probably benign 0.00
IGL02174:Emc1 APN 4 139,098,979 (GRCm39) missense possibly damaging 0.95
IGL02264:Emc1 APN 4 139,102,775 (GRCm39) missense probably damaging 1.00
IGL02501:Emc1 APN 4 139,098,295 (GRCm39) missense probably benign 0.00
IGL02697:Emc1 APN 4 139,079,955 (GRCm39) missense probably benign
IGL03355:Emc1 APN 4 139,098,904 (GRCm39) splice site probably benign
IGL03386:Emc1 APN 4 139,091,092 (GRCm39) critical splice donor site probably null
PIT4480001:Emc1 UTSW 4 139,086,588 (GRCm39) missense possibly damaging 0.69
R0023:Emc1 UTSW 4 139,098,320 (GRCm39) missense probably damaging 1.00
R0023:Emc1 UTSW 4 139,098,320 (GRCm39) missense probably damaging 1.00
R0051:Emc1 UTSW 4 139,102,474 (GRCm39) missense possibly damaging 0.81
R0094:Emc1 UTSW 4 139,087,796 (GRCm39) missense probably damaging 0.99
R0613:Emc1 UTSW 4 139,102,383 (GRCm39) splice site probably benign
R1464:Emc1 UTSW 4 139,098,248 (GRCm39) missense probably damaging 0.97
R1464:Emc1 UTSW 4 139,098,248 (GRCm39) missense probably damaging 0.97
R1512:Emc1 UTSW 4 139,087,495 (GRCm39) splice site probably null
R1702:Emc1 UTSW 4 139,102,512 (GRCm39) missense probably damaging 1.00
R1839:Emc1 UTSW 4 139,087,796 (GRCm39) missense probably damaging 0.98
R1843:Emc1 UTSW 4 139,102,823 (GRCm39) missense probably benign 0.02
R1850:Emc1 UTSW 4 139,086,684 (GRCm39) splice site probably benign
R2024:Emc1 UTSW 4 139,088,257 (GRCm39) missense possibly damaging 0.95
R2196:Emc1 UTSW 4 139,093,841 (GRCm39) missense probably benign 0.08
R2912:Emc1 UTSW 4 139,092,571 (GRCm39) missense possibly damaging 0.51
R3696:Emc1 UTSW 4 139,092,697 (GRCm39) missense possibly damaging 0.46
R3697:Emc1 UTSW 4 139,092,697 (GRCm39) missense possibly damaging 0.46
R3698:Emc1 UTSW 4 139,092,697 (GRCm39) missense possibly damaging 0.46
R3803:Emc1 UTSW 4 139,094,474 (GRCm39) missense possibly damaging 0.91
R3923:Emc1 UTSW 4 139,090,496 (GRCm39) nonsense probably null
R4738:Emc1 UTSW 4 139,089,513 (GRCm39) missense possibly damaging 0.52
R4914:Emc1 UTSW 4 139,102,476 (GRCm39) nonsense probably null
R5033:Emc1 UTSW 4 139,099,007 (GRCm39) missense probably damaging 1.00
R5322:Emc1 UTSW 4 139,081,557 (GRCm39) missense probably damaging 1.00
R5375:Emc1 UTSW 4 139,093,802 (GRCm39) missense probably damaging 0.96
R5483:Emc1 UTSW 4 139,102,687 (GRCm39) missense probably damaging 1.00
R5587:Emc1 UTSW 4 139,089,459 (GRCm39) missense probably damaging 0.98
R5687:Emc1 UTSW 4 139,102,691 (GRCm39) missense probably damaging 1.00
R5938:Emc1 UTSW 4 139,084,931 (GRCm39) missense probably benign
R6056:Emc1 UTSW 4 139,081,533 (GRCm39) missense possibly damaging 0.51
R6170:Emc1 UTSW 4 139,093,689 (GRCm39) missense probably benign 0.01
R6174:Emc1 UTSW 4 139,093,842 (GRCm39) missense probably benign 0.01
R6208:Emc1 UTSW 4 139,081,582 (GRCm39) missense probably damaging 0.99
R6340:Emc1 UTSW 4 139,092,874 (GRCm39) missense probably damaging 1.00
R6371:Emc1 UTSW 4 139,098,976 (GRCm39) nonsense probably null
R6889:Emc1 UTSW 4 139,092,661 (GRCm39) missense probably damaging 0.97
R7592:Emc1 UTSW 4 139,087,877 (GRCm39) missense probably benign 0.00
R7699:Emc1 UTSW 4 139,082,181 (GRCm39) missense probably benign
R7715:Emc1 UTSW 4 139,098,934 (GRCm39) missense probably damaging 1.00
R7984:Emc1 UTSW 4 139,102,760 (GRCm39) missense probably damaging 1.00
R8112:Emc1 UTSW 4 139,094,498 (GRCm39) missense probably benign 0.00
R8325:Emc1 UTSW 4 139,092,521 (GRCm39) missense possibly damaging 0.94
R8387:Emc1 UTSW 4 139,088,600 (GRCm39) missense probably benign
R8751:Emc1 UTSW 4 139,097,279 (GRCm39) missense possibly damaging 0.58
R9085:Emc1 UTSW 4 139,094,474 (GRCm39) missense possibly damaging 0.91
R9474:Emc1 UTSW 4 139,093,705 (GRCm39) missense probably damaging 0.98
R9482:Emc1 UTSW 4 139,088,201 (GRCm39) missense probably damaging 0.96
R9610:Emc1 UTSW 4 139,091,035 (GRCm39) missense probably benign 0.38
R9611:Emc1 UTSW 4 139,091,035 (GRCm39) missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- AGCCTTAGATAGACCCAGTGAC -3'
(R):5'- AGAGCAGAATGACACACCCTTTG -3'

Sequencing Primer
(F):5'- GATAGACCCAGTGACTTGTTTTATC -3'
(R):5'- CCTTTGTGGGCTACGGGATC -3'
Posted On 2021-11-19