Incidental Mutation 'R9032:Hsh2d'
ID 687139
Institutional Source Beutler Lab
Gene Symbol Hsh2d
Ensembl Gene ENSMUSG00000062007
Gene Name hematopoietic SH2 domain containing
Synonyms Hsh2, ALX
MMRRC Submission 068861-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.051) question?
Stock # R9032 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 72943512-72954802 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 72954385 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 256 (S256P)
Ref Sequence ENSEMBL: ENSMUSP00000071970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072097] [ENSMUST00000098630] [ENSMUST00000165324]
AlphaFold Q6VYH9
Predicted Effect probably benign
Transcript: ENSMUST00000072097
AA Change: S256P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000071970
Gene: ENSMUSG00000062007
AA Change: S256P

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
SH2 32 115 1.75e-23 SMART
low complexity region 320 329 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098630
SMART Domains Protein: ENSMUSP00000096231
Gene: ENSMUSG00000074240

DomainStartEndE-ValueType
EFh 43 71 3.97e1 SMART
EFh 80 108 4.32e1 SMART
EFh 121 149 1.57e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165324
AA Change: S256P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127575
Gene: ENSMUSG00000062007
AA Change: S256P

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
SH2 32 115 1.75e-23 SMART
low complexity region 320 329 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] T-cell activation requires 2 signals: recognition of antigen by the T-cell receptor (see TCR; MIM 186880) and a costimulatory signal provided primarily by CD28 (MIM 186760) in naive T cells. HSH2 is a target of both of these signaling pathways (Greene et al., 2003 [PubMed 12960172]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enhanced IL-2 production, increased T cell proliferation in response to TCR/CD28 stimulation, splenomegaly, and an increased frequency of activated T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik C T 15: 84,844,782 (GRCm39) M78I probably benign Het
Abca8b C T 11: 109,848,073 (GRCm39) V803M probably benign Het
Acap1 T C 11: 69,772,491 (GRCm39) E728G probably damaging Het
Afg1l G A 10: 42,194,637 (GRCm39) T385M probably damaging Het
Ankib1 T C 5: 3,819,641 (GRCm39) I93V probably benign Het
Aopep C T 13: 63,444,681 (GRCm39) R752* probably null Het
Apoa4 T A 9: 46,154,275 (GRCm39) L292Q probably damaging Het
Arhgap29 T A 3: 121,808,249 (GRCm39) D1142E probably benign Het
Asb5 A T 8: 55,038,929 (GRCm39) D265V probably benign Het
Ash1l C T 3: 88,889,294 (GRCm39) A391V probably benign Het
Ash1l T C 3: 88,891,529 (GRCm39) V1136A probably benign Het
Cacna1c G T 6: 118,615,466 (GRCm39) Y1308* probably null Het
Ctif CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC 18: 75,604,874 (GRCm39) probably benign Het
Dmtn A G 14: 70,853,534 (GRCm39) S92P probably damaging Het
Edc4 T C 8: 106,613,639 (GRCm39) F353S probably damaging Het
Emc1 T C 4: 139,094,474 (GRCm39) Y676H possibly damaging Het
Epb41l4b A T 4: 57,041,064 (GRCm39) probably null Het
Fat1 A T 8: 45,492,894 (GRCm39) N3872I probably benign Het
Fer T A 17: 64,228,767 (GRCm39) M214K probably damaging Het
Fgf17 A G 14: 70,874,436 (GRCm39) F129L probably damaging Het
Fnbp1 T C 2: 30,973,017 (GRCm39) D161G probably damaging Het
Frmd4b A C 6: 97,269,334 (GRCm39) S993A probably benign Het
Il31ra T C 13: 112,660,628 (GRCm39) S654G Het
Lmnb2 T C 10: 80,740,091 (GRCm39) D442G probably benign Het
Med19 A G 2: 84,515,660 (GRCm39) M115V probably damaging Het
Mroh5 T C 15: 73,655,302 (GRCm39) Y641C probably benign Het
Mrpl18 A T 17: 13,134,582 (GRCm39) V61E probably damaging Het
Mrtfb A C 16: 13,230,092 (GRCm39) T926P probably damaging Het
Mtap AC A 4: 89,090,515 (GRCm39) probably null Het
Muc2 T A 7: 141,287,058 (GRCm39) C154S probably damaging Het
Mypn T G 10: 62,983,894 (GRCm39) probably null Het
Naip5 T A 13: 100,356,338 (GRCm39) E1092D probably benign Het
Nes T G 3: 87,887,069 (GRCm39) V1776G possibly damaging Het
Nxn A G 11: 76,169,383 (GRCm39) I132T probably damaging Het
Oxr1 G A 15: 41,718,317 (GRCm39) V798I probably benign Het
Papss1 C A 3: 131,324,817 (GRCm39) H425N probably damaging Het
Pde4dip T C 3: 97,601,385 (GRCm39) N2344S probably benign Het
Pfas C T 11: 68,879,421 (GRCm39) G263S Het
Pknox1 C T 17: 31,822,229 (GRCm39) T332M possibly damaging Het
Plch2 T C 4: 155,084,976 (GRCm39) D321G probably damaging Het
Pnma1 T C 12: 84,193,806 (GRCm39) N299S probably benign Het
Psg23 T G 7: 18,348,660 (GRCm39) N49T possibly damaging Het
Qrfpr A G 3: 36,276,099 (GRCm39) F97S probably damaging Het
Rbl1 A G 2: 157,035,073 (GRCm39) F336L probably benign Het
Rpap1 G A 2: 119,608,776 (GRCm39) P143S probably benign Het
Rsph6a A T 7: 18,799,250 (GRCm39) N294Y probably damaging Het
Serpinb9h T C 13: 33,581,781 (GRCm39) Y113H probably damaging Het
Sesn1 C T 10: 41,686,835 (GRCm39) probably benign Het
Sh3d19 T C 3: 86,033,992 (GRCm39) Y782H probably damaging Het
Siglecg T C 7: 43,061,049 (GRCm39) V374A probably benign Het
Slc35d2 A G 13: 64,256,227 (GRCm39) F156S probably damaging Het
Slc6a11 A T 6: 114,202,808 (GRCm39) I301F probably damaging Het
Slx4ip A G 2: 136,910,240 (GRCm39) K412E possibly damaging Het
Tas2r115 A T 6: 132,714,327 (GRCm39) V208E probably benign Het
Tlcd5 C T 9: 43,022,664 (GRCm39) R230Q probably benign Het
Tmem132a G T 19: 10,843,835 (GRCm39) Q174K probably damaging Het
Tmtc1 A T 6: 148,237,749 (GRCm39) Y338* probably null Het
Vav3 C T 3: 109,413,722 (GRCm39) A220V probably benign Het
Wt1 C A 2: 104,957,160 (GRCm39) Q7K probably benign Het
Zbtb4 T A 11: 69,672,650 (GRCm39) F204L probably benign Het
Zfp51 T A 17: 21,684,660 (GRCm39) L425H probably damaging Het
Other mutations in Hsh2d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01115:Hsh2d APN 8 72,954,463 (GRCm39) missense probably damaging 0.98
IGL01134:Hsh2d APN 8 72,947,375 (GRCm39) missense probably damaging 0.96
IGL01778:Hsh2d APN 8 72,947,351 (GRCm39) missense probably damaging 1.00
IGL03324:Hsh2d APN 8 72,947,356 (GRCm39) missense probably damaging 1.00
R0002:Hsh2d UTSW 8 72,954,304 (GRCm39) missense probably benign 0.01
R0064:Hsh2d UTSW 8 72,954,304 (GRCm39) missense probably benign 0.01
R0309:Hsh2d UTSW 8 72,954,304 (GRCm39) missense probably benign 0.01
R0312:Hsh2d UTSW 8 72,954,304 (GRCm39) missense probably benign 0.01
R0369:Hsh2d UTSW 8 72,954,304 (GRCm39) missense probably benign 0.01
R0449:Hsh2d UTSW 8 72,954,304 (GRCm39) missense probably benign 0.01
R0450:Hsh2d UTSW 8 72,954,304 (GRCm39) missense probably benign 0.01
R0481:Hsh2d UTSW 8 72,954,304 (GRCm39) missense probably benign 0.01
R0483:Hsh2d UTSW 8 72,954,304 (GRCm39) missense probably benign 0.01
R0554:Hsh2d UTSW 8 72,954,304 (GRCm39) missense probably benign 0.01
R0704:Hsh2d UTSW 8 72,954,304 (GRCm39) missense probably benign 0.01
R0843:Hsh2d UTSW 8 72,954,304 (GRCm39) missense probably benign 0.01
R0947:Hsh2d UTSW 8 72,954,304 (GRCm39) missense probably benign 0.01
R0948:Hsh2d UTSW 8 72,954,304 (GRCm39) missense probably benign 0.01
R0966:Hsh2d UTSW 8 72,954,304 (GRCm39) missense probably benign 0.01
R0967:Hsh2d UTSW 8 72,954,304 (GRCm39) missense probably benign 0.01
R1051:Hsh2d UTSW 8 72,954,304 (GRCm39) missense probably benign 0.01
R1055:Hsh2d UTSW 8 72,954,304 (GRCm39) missense probably benign 0.01
R1076:Hsh2d UTSW 8 72,954,304 (GRCm39) missense probably benign 0.01
R1105:Hsh2d UTSW 8 72,954,304 (GRCm39) missense probably benign 0.01
R1108:Hsh2d UTSW 8 72,954,304 (GRCm39) missense probably benign 0.01
R1144:Hsh2d UTSW 8 72,947,436 (GRCm39) splice site probably benign
R1150:Hsh2d UTSW 8 72,954,304 (GRCm39) missense probably benign 0.01
R1186:Hsh2d UTSW 8 72,954,304 (GRCm39) missense probably benign 0.01
R1345:Hsh2d UTSW 8 72,954,304 (GRCm39) missense probably benign 0.01
R1371:Hsh2d UTSW 8 72,950,738 (GRCm39) splice site probably benign
R1400:Hsh2d UTSW 8 72,954,304 (GRCm39) missense probably benign 0.01
R1419:Hsh2d UTSW 8 72,954,304 (GRCm39) missense probably benign 0.01
R1430:Hsh2d UTSW 8 72,954,304 (GRCm39) missense probably benign 0.01
R1514:Hsh2d UTSW 8 72,954,304 (GRCm39) missense probably benign 0.01
R1551:Hsh2d UTSW 8 72,954,304 (GRCm39) missense probably benign 0.01
R1691:Hsh2d UTSW 8 72,954,304 (GRCm39) missense probably benign 0.01
R1857:Hsh2d UTSW 8 72,954,304 (GRCm39) missense probably benign 0.01
R1859:Hsh2d UTSW 8 72,954,304 (GRCm39) missense probably benign 0.01
R1914:Hsh2d UTSW 8 72,947,365 (GRCm39) missense probably damaging 1.00
R1915:Hsh2d UTSW 8 72,947,365 (GRCm39) missense probably damaging 1.00
R1982:Hsh2d UTSW 8 72,954,304 (GRCm39) missense probably benign 0.01
R2050:Hsh2d UTSW 8 72,954,304 (GRCm39) missense probably benign 0.01
R2081:Hsh2d UTSW 8 72,954,304 (GRCm39) missense probably benign 0.01
R2105:Hsh2d UTSW 8 72,954,490 (GRCm39) missense probably benign
R4077:Hsh2d UTSW 8 72,954,304 (GRCm39) missense probably benign 0.01
R4078:Hsh2d UTSW 8 72,954,304 (GRCm39) missense probably benign 0.01
R4823:Hsh2d UTSW 8 72,954,304 (GRCm39) missense probably benign 0.01
R4824:Hsh2d UTSW 8 72,954,304 (GRCm39) missense probably benign 0.01
R4903:Hsh2d UTSW 8 72,947,372 (GRCm39) missense probably benign
R4966:Hsh2d UTSW 8 72,947,372 (GRCm39) missense probably benign
R6550:Hsh2d UTSW 8 72,952,297 (GRCm39) missense probably benign
R7418:Hsh2d UTSW 8 72,950,638 (GRCm39) critical splice acceptor site probably null
R7673:Hsh2d UTSW 8 72,954,355 (GRCm39) missense probably benign 0.15
R7911:Hsh2d UTSW 8 72,950,648 (GRCm39) missense probably damaging 1.00
R8890:Hsh2d UTSW 8 72,951,690 (GRCm39) missense probably damaging 1.00
Y4335:Hsh2d UTSW 8 72,954,304 (GRCm39) missense probably benign 0.01
Y4336:Hsh2d UTSW 8 72,954,304 (GRCm39) missense probably benign 0.01
Y4337:Hsh2d UTSW 8 72,954,304 (GRCm39) missense probably benign 0.01
Y4338:Hsh2d UTSW 8 72,954,304 (GRCm39) missense probably benign 0.01
Predicted Primers
Posted On 2021-11-19