Incidental Mutation 'R9032:Lmnb2'
ID 687144
Institutional Source Beutler Lab
Gene Symbol Lmnb2
Ensembl Gene ENSMUSG00000062075
Gene Name lamin B2
Synonyms lamin B3
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9032 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 80901203-80918245 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 80904257 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 442 (D442G)
Ref Sequence ENSEMBL: ENSMUSP00000057291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020440] [ENSMUST00000057623] [ENSMUST00000105332] [ENSMUST00000105333] [ENSMUST00000179022] [ENSMUST00000218481] [ENSMUST00000219817] [ENSMUST00000219896]
AlphaFold P21619
Predicted Effect probably benign
Transcript: ENSMUST00000020440
SMART Domains Protein: ENSMUSP00000020440
Gene: ENSMUSG00000020219

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:zf-Tim10_DDP 23 87 4.6e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000057623
AA Change: D442G

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000057291
Gene: ENSMUSG00000062075
AA Change: D442G

DomainStartEndE-ValueType
Filament 42 398 1.97e-47 SMART
low complexity region 402 422 N/A INTRINSIC
internal_repeat_1 427 442 1.72e-5 PROSPERO
low complexity region 444 458 N/A INTRINSIC
Pfam:LTD 462 575 9.3e-16 PFAM
low complexity region 579 596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105332
AA Change: D301G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000100969
Gene: ENSMUSG00000062075
AA Change: D301G

DomainStartEndE-ValueType
Pfam:Filament 77 257 1.2e-49 PFAM
low complexity region 261 281 N/A INTRINSIC
Pfam:LTD 317 435 6.7e-23 PFAM
low complexity region 438 455 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105333
SMART Domains Protein: ENSMUSP00000100970
Gene: ENSMUSG00000059406

DomainStartEndE-ValueType
Pfam:SEA 62 155 1.7e-10 PFAM
LDLa 189 227 1.15e-4 SMART
Tryp_SPc 238 467 2.43e-96 SMART
low complexity region 477 502 N/A INTRINSIC
Tryp_SPc 539 767 7.28e-86 SMART
Tryp_SPc 867 1093 1.62e-92 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179022
AA Change: D423G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000136524
Gene: ENSMUSG00000062075
AA Change: D423G

DomainStartEndE-ValueType
Pfam:Filament 23 379 8.9e-96 PFAM
low complexity region 383 403 N/A INTRINSIC
internal_repeat_1 408 423 1.1e-5 PROSPERO
Pfam:LTD 439 557 1.3e-23 PFAM
low complexity region 560 577 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218481
Predicted Effect probably benign
Transcript: ENSMUST00000219817
Predicted Effect probably benign
Transcript: ENSMUST00000219896
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a B type nuclear lamin. The nuclear lamina consists of a two-dimensional matrix of proteins located next to the inner nuclear membrane. The lamin family of proteins make up the matrix and are highly conserved in evolution. During mitosis, the lamina matrix is reversibly disassembled as the lamin proteins are phosphorylated. Lamin proteins are thought to be involved in nuclear stability, chromatin structure and gene expression. Vertebrate lamins consist of two types, A and B. Mutations in this gene are associated with acquired partial lipodystrophy. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal death with abnormal brain development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik C T 13: 63,296,867 R752* probably null Het
5031439G07Rik C T 15: 84,960,581 M78I probably benign Het
Abca8b C T 11: 109,957,247 V803M probably benign Het
Acap1 T C 11: 69,881,665 E728G probably damaging Het
Afg1l G A 10: 42,318,641 T385M probably damaging Het
Ankib1 T C 5: 3,769,641 I93V probably benign Het
Apoa4 T A 9: 46,242,977 L292Q probably damaging Het
Arhgap29 T A 3: 122,014,600 D1142E probably benign Het
Asb5 A T 8: 54,585,894 D265V probably benign Het
Ash1l C T 3: 88,981,987 A391V probably benign Het
Ash1l T C 3: 88,984,222 V1136A probably benign Het
Cacna1c G T 6: 118,638,505 Y1308* probably null Het
Ctif CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC 18: 75,471,803 probably benign Het
Dmtn A G 14: 70,616,094 S92P probably damaging Het
Edc4 T C 8: 105,887,007 F353S probably damaging Het
Emc1 T C 4: 139,367,163 Y676H possibly damaging Het
Fat1 A T 8: 45,039,857 N3872I probably benign Het
Fer T A 17: 63,921,772 M214K probably damaging Het
Fgf17 A G 14: 70,636,996 F129L probably damaging Het
Fnbp1 T C 2: 31,083,005 D161G probably damaging Het
Frmd4b A C 6: 97,292,373 S993A probably benign Het
Gm11397 T C 13: 33,397,798 Y113H probably damaging Het
Hsh2d T C 8: 72,200,541 S256P probably benign Het
Il31ra T C 13: 112,524,094 S654G Het
Med19 A G 2: 84,685,316 M115V probably damaging Het
Mkl2 A C 16: 13,412,228 T926P probably damaging Het
Mrpl18 A T 17: 12,915,695 V61E probably damaging Het
Mtap AC A 4: 89,172,278 probably null Het
Muc2 T A 7: 141,700,489 C154S probably damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Nes T G 3: 87,979,762 V1776G possibly damaging Het
Nxn A G 11: 76,278,557 I132T probably damaging Het
Oxr1 G A 15: 41,854,921 V798I probably benign Het
Papss1 C A 3: 131,619,056 H425N probably damaging Het
Pde4dip T C 3: 97,694,069 N2344S probably benign Het
Pfas C T 11: 68,988,595 G263S Het
Pknox1 C T 17: 31,603,255 T332M possibly damaging Het
Plch2 T C 4: 155,000,519 D321G probably damaging Het
Pnma1 T C 12: 84,147,032 N299S probably benign Het
Psg23 T G 7: 18,614,735 N49T possibly damaging Het
Qrfpr A G 3: 36,221,950 F97S probably damaging Het
Rbl1 A G 2: 157,193,153 F336L probably benign Het
Rsph6a A T 7: 19,065,325 N294Y probably damaging Het
Sh3d19 T C 3: 86,126,685 Y782H probably damaging Het
Siglecg T C 7: 43,411,625 V374A probably benign Het
Slc35d2 A G 13: 64,108,413 F156S probably damaging Het
Slc6a11 A T 6: 114,225,847 I301F probably damaging Het
Slx4ip A G 2: 137,068,320 K412E possibly damaging Het
Tas2r115 A T 6: 132,737,364 V208E probably benign Het
Tmem132a G T 19: 10,866,471 Q174K probably damaging Het
Tmem136 C T 9: 43,111,369 R230Q probably benign Het
Tmtc1 A T 6: 148,336,251 Y338* probably null Het
Vav3 C T 3: 109,506,406 A220V probably benign Het
Wt1 C A 2: 105,126,815 Q7K probably benign Het
Zbtb4 T A 11: 69,781,824 F204L probably benign Het
Zfp51 T A 17: 21,464,398 L425H probably damaging Het
Other mutations in Lmnb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Lmnb2 APN 10 80904037 missense possibly damaging 0.92
IGL00908:Lmnb2 APN 10 80909987 missense probably damaging 0.99
IGL01365:Lmnb2 APN 10 80904984 missense probably benign 0.07
IGL01598:Lmnb2 APN 10 80907165 missense probably benign 0.00
R0761:Lmnb2 UTSW 10 80906254 start codon destroyed probably null 0.03
R1143:Lmnb2 UTSW 10 80904315 unclassified probably benign
R1324:Lmnb2 UTSW 10 80904171 missense possibly damaging 0.60
R1763:Lmnb2 UTSW 10 80907191 missense probably damaging 1.00
R2229:Lmnb2 UTSW 10 80904392 unclassified probably benign
R5001:Lmnb2 UTSW 10 80918112 missense probably damaging 0.98
R5053:Lmnb2 UTSW 10 80904655 missense probably damaging 1.00
R5334:Lmnb2 UTSW 10 80903957 missense probably benign 0.08
R5713:Lmnb2 UTSW 10 80906087 missense probably damaging 0.97
R5975:Lmnb2 UTSW 10 80905128 nonsense probably null
R6314:Lmnb2 UTSW 10 80909970 missense probably damaging 1.00
R6835:Lmnb2 UTSW 10 80909960 missense probably damaging 1.00
R7663:Lmnb2 UTSW 10 80904739 missense probably damaging 1.00
R7776:Lmnb2 UTSW 10 80918157 missense possibly damaging 0.52
R8230:Lmnb2 UTSW 10 80905148 missense probably damaging 0.97
R8728:Lmnb2 UTSW 10 80905079 critical splice donor site probably null
R9063:Lmnb2 UTSW 10 80906171 missense probably benign 0.00
R9085:Lmnb2 UTSW 10 80904257 missense probably benign 0.03
Z1176:Lmnb2 UTSW 10 80903238 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGACCTGCTTTTAACCTCTGGC -3'
(R):5'- GCAGAGCTTCAAAAGAGGTCC -3'

Sequencing Primer
(F):5'- TGGCCACCAGGAAAGCG -3'
(R):5'- CTTCAAAAGAGGTCCAGAGGCTG -3'
Posted On 2021-11-19