Incidental Mutation 'R9032:Abca8b'
ID 687149
Institutional Source Beutler Lab
Gene Symbol Abca8b
Ensembl Gene ENSMUSG00000020620
Gene Name ATP-binding cassette, sub-family A (ABC1), member 8b
Synonyms Abca8
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9032 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 109932190-109995845 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 109957247 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 803 (V803M)
Ref Sequence ENSEMBL: ENSMUSP00000020948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020948] [ENSMUST00000106669]
AlphaFold Q8K440
Predicted Effect probably benign
Transcript: ENSMUST00000020948
AA Change: V803M

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000020948
Gene: ENSMUSG00000020620
AA Change: V803M

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 28 417 3.9e-28 PFAM
AAA 507 691 6.36e-10 SMART
Pfam:ABC2_membrane_3 859 1215 1e-10 PFAM
low complexity region 1246 1255 N/A INTRINSIC
AAA 1313 1492 6.17e-8 SMART
low complexity region 1597 1607 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106669
AA Change: V741M

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102280
Gene: ENSMUSG00000020620
AA Change: V741M

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 28 344 2.6e-16 PFAM
AAA 445 629 6.36e-10 SMART
transmembrane domain 798 815 N/A INTRINSIC
transmembrane domain 1001 1023 N/A INTRINSIC
transmembrane domain 1038 1060 N/A INTRINSIC
transmembrane domain 1072 1091 N/A INTRINSIC
transmembrane domain 1101 1123 N/A INTRINSIC
transmembrane domain 1136 1158 N/A INTRINSIC
low complexity region 1184 1193 N/A INTRINSIC
AAA 1251 1430 6.17e-8 SMART
low complexity region 1535 1545 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. The encoded protein may regulate lipid metabolism and be involved in the formation and maintenance of myelin. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik C T 13: 63,296,867 R752* probably null Het
5031439G07Rik C T 15: 84,960,581 M78I probably benign Het
Acap1 T C 11: 69,881,665 E728G probably damaging Het
Afg1l G A 10: 42,318,641 T385M probably damaging Het
Ankib1 T C 5: 3,769,641 I93V probably benign Het
Apoa4 T A 9: 46,242,977 L292Q probably damaging Het
Arhgap29 T A 3: 122,014,600 D1142E probably benign Het
Asb5 A T 8: 54,585,894 D265V probably benign Het
Ash1l C T 3: 88,981,987 A391V probably benign Het
Ash1l T C 3: 88,984,222 V1136A probably benign Het
Cacna1c G T 6: 118,638,505 Y1308* probably null Het
Ctif CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC 18: 75,471,803 probably benign Het
Dmtn A G 14: 70,616,094 S92P probably damaging Het
Edc4 T C 8: 105,887,007 F353S probably damaging Het
Emc1 T C 4: 139,367,163 Y676H possibly damaging Het
Epb41l4b A T 4: 57,041,064 probably null Het
Fat1 A T 8: 45,039,857 N3872I probably benign Het
Fer T A 17: 63,921,772 M214K probably damaging Het
Fgf17 A G 14: 70,636,996 F129L probably damaging Het
Fnbp1 T C 2: 31,083,005 D161G probably damaging Het
Frmd4b A C 6: 97,292,373 S993A probably benign Het
Gm11397 T C 13: 33,397,798 Y113H probably damaging Het
Hsh2d T C 8: 72,200,541 S256P probably benign Het
Il31ra T C 13: 112,524,094 S654G Het
Lmnb2 T C 10: 80,904,257 D442G probably benign Het
Med19 A G 2: 84,685,316 M115V probably damaging Het
Mkl2 A C 16: 13,412,228 T926P probably damaging Het
Mroh5 T C 15: 73,783,453 Y641C probably benign Het
Mrpl18 A T 17: 12,915,695 V61E probably damaging Het
Mtap AC A 4: 89,172,278 probably null Het
Muc2 T A 7: 141,700,489 C154S probably damaging Het
Mypn T G 10: 63,148,115 probably null Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Nes T G 3: 87,979,762 V1776G possibly damaging Het
Nxn A G 11: 76,278,557 I132T probably damaging Het
Oxr1 G A 15: 41,854,921 V798I probably benign Het
Papss1 C A 3: 131,619,056 H425N probably damaging Het
Pde4dip T C 3: 97,694,069 N2344S probably benign Het
Pfas C T 11: 68,988,595 G263S Het
Pknox1 C T 17: 31,603,255 T332M possibly damaging Het
Plch2 T C 4: 155,000,519 D321G probably damaging Het
Pnma1 T C 12: 84,147,032 N299S probably benign Het
Psg23 T G 7: 18,614,735 N49T possibly damaging Het
Qrfpr A G 3: 36,221,950 F97S probably damaging Het
Rbl1 A G 2: 157,193,153 F336L probably benign Het
Rpap1 G A 2: 119,778,295 P143S probably benign Het
Rsph6a A T 7: 19,065,325 N294Y probably damaging Het
Sesn1 C T 10: 41,810,839 probably benign Het
Sh3d19 T C 3: 86,126,685 Y782H probably damaging Het
Siglecg T C 7: 43,411,625 V374A probably benign Het
Slc35d2 A G 13: 64,108,413 F156S probably damaging Het
Slc6a11 A T 6: 114,225,847 I301F probably damaging Het
Slx4ip A G 2: 137,068,320 K412E possibly damaging Het
Tas2r115 A T 6: 132,737,364 V208E probably benign Het
Tmem132a G T 19: 10,866,471 Q174K probably damaging Het
Tmem136 C T 9: 43,111,369 R230Q probably benign Het
Tmtc1 A T 6: 148,336,251 Y338* probably null Het
Vav3 C T 3: 109,506,406 A220V probably benign Het
Wt1 C A 2: 105,126,815 Q7K probably benign Het
Zbtb4 T A 11: 69,781,824 F204L probably benign Het
Zfp51 T A 17: 21,464,398 L425H probably damaging Het
Other mutations in Abca8b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00862:Abca8b APN 11 109953548 missense possibly damaging 0.66
IGL00952:Abca8b APN 11 109969060 critical splice donor site probably null
IGL01141:Abca8b APN 11 109937730 missense probably damaging 1.00
IGL01523:Abca8b APN 11 109976494 missense probably damaging 1.00
IGL01633:Abca8b APN 11 109936754 missense probably damaging 0.99
IGL01862:Abca8b APN 11 109947171 nonsense probably null
IGL01963:Abca8b APN 11 109971763 missense probably damaging 0.99
IGL02169:Abca8b APN 11 109952582 missense probably damaging 0.98
IGL02536:Abca8b APN 11 109981748 missense probably benign 0.02
IGL02658:Abca8b APN 11 109952560 missense probably benign
IGL02828:Abca8b APN 11 109980894 missense probably damaging 0.99
IGL03118:Abca8b APN 11 109947181 missense possibly damaging 0.66
IGL03302:Abca8b APN 11 109967750 missense possibly damaging 0.80
IGL03325:Abca8b APN 11 109953596 missense possibly damaging 0.94
R0057:Abca8b UTSW 11 109941559 missense possibly damaging 0.91
R0131:Abca8b UTSW 11 109942289 missense possibly damaging 0.46
R0226:Abca8b UTSW 11 109957018 splice site probably null
R0426:Abca8b UTSW 11 109955027 splice site probably benign
R0432:Abca8b UTSW 11 109980015 missense possibly damaging 0.94
R0512:Abca8b UTSW 11 109950650 missense probably benign 0.32
R0589:Abca8b UTSW 11 109942268 missense probably damaging 0.96
R0690:Abca8b UTSW 11 109969808 splice site probably benign
R1263:Abca8b UTSW 11 109941607 missense possibly damaging 0.66
R1371:Abca8b UTSW 11 109953553 missense probably damaging 0.99
R1497:Abca8b UTSW 11 109973821 splice site probably benign
R1502:Abca8b UTSW 11 109974645 missense probably damaging 1.00
R1517:Abca8b UTSW 11 109971814 missense possibly damaging 0.66
R1543:Abca8b UTSW 11 109974674 missense probably damaging 0.98
R1618:Abca8b UTSW 11 109949888 splice site probably benign
R1625:Abca8b UTSW 11 109967121 missense probably benign 0.11
R1753:Abca8b UTSW 11 109973716 missense probably benign 0.00
R1819:Abca8b UTSW 11 109981056 critical splice acceptor site probably null
R1822:Abca8b UTSW 11 109957075 missense possibly damaging 0.92
R1829:Abca8b UTSW 11 109942341 missense probably damaging 0.97
R1873:Abca8b UTSW 11 109979955 missense probably benign 0.01
R1899:Abca8b UTSW 11 109937918 missense possibly damaging 0.92
R1908:Abca8b UTSW 11 109957098 missense possibly damaging 0.92
R1962:Abca8b UTSW 11 109979898 missense probably benign 0.00
R1984:Abca8b UTSW 11 109977841 missense probably damaging 1.00
R2035:Abca8b UTSW 11 109957106 missense possibly damaging 0.94
R2092:Abca8b UTSW 11 109966708 missense possibly damaging 0.63
R2100:Abca8b UTSW 11 109937782 missense probably damaging 1.00
R2267:Abca8b UTSW 11 109955148 missense probably benign 0.03
R2871:Abca8b UTSW 11 109955176 missense possibly damaging 0.83
R2871:Abca8b UTSW 11 109955176 missense possibly damaging 0.83
R2872:Abca8b UTSW 11 109955176 missense possibly damaging 0.83
R2872:Abca8b UTSW 11 109955176 missense possibly damaging 0.83
R2873:Abca8b UTSW 11 109955176 missense possibly damaging 0.83
R3711:Abca8b UTSW 11 109946255 missense possibly damaging 0.46
R3937:Abca8b UTSW 11 109974567 missense probably benign 0.01
R4052:Abca8b UTSW 11 109981725 nonsense probably null
R4060:Abca8b UTSW 11 109957201 missense probably benign 0.04
R4207:Abca8b UTSW 11 109981725 nonsense probably null
R4208:Abca8b UTSW 11 109981725 nonsense probably null
R4354:Abca8b UTSW 11 109971692 missense probably benign 0.27
R4399:Abca8b UTSW 11 109936385 missense possibly damaging 0.66
R4456:Abca8b UTSW 11 109942245 missense probably benign 0.27
R4509:Abca8b UTSW 11 109966755 missense probably damaging 1.00
R4672:Abca8b UTSW 11 109936448 missense possibly damaging 0.81
R4868:Abca8b UTSW 11 109974512 missense probably benign 0.05
R5002:Abca8b UTSW 11 109961797 missense probably damaging 0.96
R5007:Abca8b UTSW 11 109936764 missense probably damaging 1.00
R5014:Abca8b UTSW 11 109950131 missense probably damaging 0.98
R5023:Abca8b UTSW 11 109974988 critical splice donor site probably null
R5091:Abca8b UTSW 11 109936384 missense possibly damaging 0.92
R5098:Abca8b UTSW 11 109957118 missense probably benign 0.05
R5117:Abca8b UTSW 11 109966803 missense probably damaging 1.00
R5234:Abca8b UTSW 11 109976594 missense possibly damaging 0.90
R5302:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5307:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5487:Abca8b UTSW 11 109953514 missense probably damaging 0.99
R5512:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5564:Abca8b UTSW 11 109934581 missense probably benign 0.08
R5610:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5677:Abca8b UTSW 11 109940861 missense probably damaging 1.00
R5723:Abca8b UTSW 11 109953619 missense possibly damaging 0.90
R5827:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5829:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5848:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5849:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5850:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5854:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5982:Abca8b UTSW 11 109953597 missense possibly damaging 0.80
R5994:Abca8b UTSW 11 109949766 splice site probably null
R6035:Abca8b UTSW 11 109971860 splice site probably null
R6035:Abca8b UTSW 11 109971860 splice site probably null
R6050:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R6145:Abca8b UTSW 11 109973808 missense probably benign 0.03
R6223:Abca8b UTSW 11 109977846 missense probably benign 0.00
R6349:Abca8b UTSW 11 109934718 splice site probably null
R7002:Abca8b UTSW 11 109941564 missense probably damaging 1.00
R7050:Abca8b UTSW 11 109973718 missense possibly damaging 0.90
R7107:Abca8b UTSW 11 109976473 missense probably damaging 0.98
R7158:Abca8b UTSW 11 109934589 missense probably damaging 1.00
R7170:Abca8b UTSW 11 109945828 missense probably benign 0.09
R7197:Abca8b UTSW 11 109945822 nonsense probably null
R7220:Abca8b UTSW 11 109981717 missense probably damaging 1.00
R7512:Abca8b UTSW 11 109938449 missense probably benign 0.01
R7590:Abca8b UTSW 11 109938515 missense probably damaging 0.97
R7658:Abca8b UTSW 11 109935717 missense probably benign 0.00
R7739:Abca8b UTSW 11 109974591 missense probably benign 0.05
R7797:Abca8b UTSW 11 109971683 critical splice donor site probably null
R7934:Abca8b UTSW 11 109975039 missense possibly damaging 0.75
R8074:Abca8b UTSW 11 109938494 missense probably benign
R8302:Abca8b UTSW 11 109962580 critical splice donor site probably null
R8341:Abca8b UTSW 11 109955050 missense probably damaging 1.00
R8486:Abca8b UTSW 11 109967111 missense possibly damaging 0.83
R8748:Abca8b UTSW 11 109945771 missense probably damaging 1.00
R8924:Abca8b UTSW 11 109947177 missense probably benign 0.00
R9002:Abca8b UTSW 11 109952630 missense probably benign 0.02
R9099:Abca8b UTSW 11 109980882 missense probably damaging 1.00
R9124:Abca8b UTSW 11 109937767 missense probably damaging 0.97
R9178:Abca8b UTSW 11 109950111 missense probably benign 0.00
R9188:Abca8b UTSW 11 109981735 nonsense probably null
R9277:Abca8b UTSW 11 109976521 missense probably damaging 0.99
R9340:Abca8b UTSW 11 109950113 missense probably benign 0.43
R9371:Abca8b UTSW 11 109967672 missense probably damaging 1.00
R9382:Abca8b UTSW 11 109979885 missense probably benign
R9450:Abca8b UTSW 11 109969104 missense probably damaging 0.98
R9462:Abca8b UTSW 11 109953607 missense
R9712:Abca8b UTSW 11 109942337 missense probably benign 0.30
Z1088:Abca8b UTSW 11 109976482 missense probably benign 0.09
Z1176:Abca8b UTSW 11 109961908 missense possibly damaging 0.52
Z1176:Abca8b UTSW 11 109974644 missense possibly damaging 0.87
Predicted Primers
Posted On 2021-11-19