Incidental Mutation 'R9032:Naip5'
ID 687154
Institutional Source Beutler Lab
Gene Symbol Naip5
Ensembl Gene ENSMUSG00000071203
Gene Name NLR family, apoptosis inhibitory protein 5
Synonyms Birc1e, Naip-rs3, Lgn1
MMRRC Submission 068861-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.082) question?
Stock # R9032 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 100348247-100382831 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 100356338 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 1092 (E1092D)
Ref Sequence ENSEMBL: ENSMUSP00000058611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049789]
AlphaFold Q9R016
Predicted Effect probably benign
Transcript: ENSMUST00000049789
AA Change: E1092D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000058611
Gene: ENSMUSG00000071203
AA Change: E1092D

DomainStartEndE-ValueType
low complexity region 36 51 N/A INTRINSIC
BIR 58 129 1.08e-19 SMART
BIR 157 229 1.06e-36 SMART
BIR 276 347 2.14e-32 SMART
Pfam:NACHT 464 618 1.7e-36 PFAM
low complexity region 851 862 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (56/56)
MGI Phenotype PHENOTYPE: This locus controls resistance to Legionella pneumophila, the organism responsible for Legionnaire's disease. Cultured peritoneal macrophages from A/J mice are susceptible, supporting bacterial proliferation; other strains, e.g., C57BL/6 are resistant. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik C T 15: 84,844,782 (GRCm39) M78I probably benign Het
Abca8b C T 11: 109,848,073 (GRCm39) V803M probably benign Het
Acap1 T C 11: 69,772,491 (GRCm39) E728G probably damaging Het
Afg1l G A 10: 42,194,637 (GRCm39) T385M probably damaging Het
Ankib1 T C 5: 3,819,641 (GRCm39) I93V probably benign Het
Aopep C T 13: 63,444,681 (GRCm39) R752* probably null Het
Apoa4 T A 9: 46,154,275 (GRCm39) L292Q probably damaging Het
Arhgap29 T A 3: 121,808,249 (GRCm39) D1142E probably benign Het
Asb5 A T 8: 55,038,929 (GRCm39) D265V probably benign Het
Ash1l C T 3: 88,889,294 (GRCm39) A391V probably benign Het
Ash1l T C 3: 88,891,529 (GRCm39) V1136A probably benign Het
Cacna1c G T 6: 118,615,466 (GRCm39) Y1308* probably null Het
Ctif CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC 18: 75,604,874 (GRCm39) probably benign Het
Dmtn A G 14: 70,853,534 (GRCm39) S92P probably damaging Het
Edc4 T C 8: 106,613,639 (GRCm39) F353S probably damaging Het
Emc1 T C 4: 139,094,474 (GRCm39) Y676H possibly damaging Het
Epb41l4b A T 4: 57,041,064 (GRCm39) probably null Het
Fat1 A T 8: 45,492,894 (GRCm39) N3872I probably benign Het
Fer T A 17: 64,228,767 (GRCm39) M214K probably damaging Het
Fgf17 A G 14: 70,874,436 (GRCm39) F129L probably damaging Het
Fnbp1 T C 2: 30,973,017 (GRCm39) D161G probably damaging Het
Frmd4b A C 6: 97,269,334 (GRCm39) S993A probably benign Het
Hsh2d T C 8: 72,954,385 (GRCm39) S256P probably benign Het
Il31ra T C 13: 112,660,628 (GRCm39) S654G Het
Lmnb2 T C 10: 80,740,091 (GRCm39) D442G probably benign Het
Med19 A G 2: 84,515,660 (GRCm39) M115V probably damaging Het
Mroh5 T C 15: 73,655,302 (GRCm39) Y641C probably benign Het
Mrpl18 A T 17: 13,134,582 (GRCm39) V61E probably damaging Het
Mrtfb A C 16: 13,230,092 (GRCm39) T926P probably damaging Het
Mtap AC A 4: 89,090,515 (GRCm39) probably null Het
Muc2 T A 7: 141,287,058 (GRCm39) C154S probably damaging Het
Mypn T G 10: 62,983,894 (GRCm39) probably null Het
Nes T G 3: 87,887,069 (GRCm39) V1776G possibly damaging Het
Nxn A G 11: 76,169,383 (GRCm39) I132T probably damaging Het
Oxr1 G A 15: 41,718,317 (GRCm39) V798I probably benign Het
Papss1 C A 3: 131,324,817 (GRCm39) H425N probably damaging Het
Pde4dip T C 3: 97,601,385 (GRCm39) N2344S probably benign Het
Pfas C T 11: 68,879,421 (GRCm39) G263S Het
Pknox1 C T 17: 31,822,229 (GRCm39) T332M possibly damaging Het
Plch2 T C 4: 155,084,976 (GRCm39) D321G probably damaging Het
Pnma1 T C 12: 84,193,806 (GRCm39) N299S probably benign Het
Psg23 T G 7: 18,348,660 (GRCm39) N49T possibly damaging Het
Qrfpr A G 3: 36,276,099 (GRCm39) F97S probably damaging Het
Rbl1 A G 2: 157,035,073 (GRCm39) F336L probably benign Het
Rpap1 G A 2: 119,608,776 (GRCm39) P143S probably benign Het
Rsph6a A T 7: 18,799,250 (GRCm39) N294Y probably damaging Het
Serpinb9h T C 13: 33,581,781 (GRCm39) Y113H probably damaging Het
Sesn1 C T 10: 41,686,835 (GRCm39) probably benign Het
Sh3d19 T C 3: 86,033,992 (GRCm39) Y782H probably damaging Het
Siglecg T C 7: 43,061,049 (GRCm39) V374A probably benign Het
Slc35d2 A G 13: 64,256,227 (GRCm39) F156S probably damaging Het
Slc6a11 A T 6: 114,202,808 (GRCm39) I301F probably damaging Het
Slx4ip A G 2: 136,910,240 (GRCm39) K412E possibly damaging Het
Tas2r115 A T 6: 132,714,327 (GRCm39) V208E probably benign Het
Tlcd5 C T 9: 43,022,664 (GRCm39) R230Q probably benign Het
Tmem132a G T 19: 10,843,835 (GRCm39) Q174K probably damaging Het
Tmtc1 A T 6: 148,237,749 (GRCm39) Y338* probably null Het
Vav3 C T 3: 109,413,722 (GRCm39) A220V probably benign Het
Wt1 C A 2: 104,957,160 (GRCm39) Q7K probably benign Het
Zbtb4 T A 11: 69,672,650 (GRCm39) F204L probably benign Het
Zfp51 T A 17: 21,684,660 (GRCm39) L425H probably damaging Het
Other mutations in Naip5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Naip5 APN 13 100,382,683 (GRCm39) nonsense probably null
IGL00493:Naip5 APN 13 100,367,279 (GRCm39) missense probably damaging 0.96
IGL01294:Naip5 APN 13 100,353,588 (GRCm39) missense probably damaging 0.99
IGL01405:Naip5 APN 13 100,358,453 (GRCm39) missense probably benign 0.11
IGL01568:Naip5 APN 13 100,353,609 (GRCm39) missense probably benign 0.26
IGL01804:Naip5 APN 13 100,358,092 (GRCm39) missense probably damaging 1.00
IGL02012:Naip5 APN 13 100,359,847 (GRCm39) missense probably benign 0.01
IGL02183:Naip5 APN 13 100,358,150 (GRCm39) missense probably benign 0.41
IGL02449:Naip5 APN 13 100,358,683 (GRCm39) missense probably benign 0.34
IGL02815:Naip5 APN 13 100,359,239 (GRCm39) missense probably benign
IGL02992:Naip5 APN 13 100,359,536 (GRCm39) missense probably damaging 1.00
IGL03027:Naip5 APN 13 100,359,524 (GRCm39) missense probably benign 0.00
IGL03234:Naip5 APN 13 100,349,135 (GRCm39) missense probably damaging 1.00
inwood2 UTSW 13 100,359,522 (GRCm39) nonsense probably null
inwood3 UTSW 13 100,358,411 (GRCm39) nonsense probably null
Nuchal UTSW 13 100,351,171 (GRCm39) missense possibly damaging 0.82
PIT4131001:Naip5 UTSW 13 100,356,268 (GRCm39) missense probably benign 0.00
PIT4131001:Naip5 UTSW 13 100,356,247 (GRCm39) missense probably benign
R0001:Naip5 UTSW 13 100,359,622 (GRCm39) missense probably benign
R0001:Naip5 UTSW 13 100,351,158 (GRCm39) critical splice donor site probably null
R0462:Naip5 UTSW 13 100,358,240 (GRCm39) missense probably damaging 1.00
R0636:Naip5 UTSW 13 100,356,196 (GRCm39) missense probably benign
R0674:Naip5 UTSW 13 100,359,707 (GRCm39) missense probably benign 0.04
R0764:Naip5 UTSW 13 100,353,613 (GRCm39) missense probably benign 0.03
R0837:Naip5 UTSW 13 100,367,251 (GRCm39) missense probably benign
R1179:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R1302:Naip5 UTSW 13 100,358,099 (GRCm39) missense possibly damaging 0.91
R1441:Naip5 UTSW 13 100,356,225 (GRCm39) missense possibly damaging 0.95
R1513:Naip5 UTSW 13 100,358,714 (GRCm39) missense probably benign
R1638:Naip5 UTSW 13 100,349,177 (GRCm39) missense probably damaging 1.00
R1651:Naip5 UTSW 13 100,358,419 (GRCm39) missense probably benign 0.41
R1707:Naip5 UTSW 13 100,379,363 (GRCm39) missense probably damaging 1.00
R1835:Naip5 UTSW 13 100,359,726 (GRCm39) nonsense probably null
R1836:Naip5 UTSW 13 100,356,195 (GRCm39) missense probably benign 0.18
R1972:Naip5 UTSW 13 100,349,278 (GRCm39) missense probably damaging 0.98
R2080:Naip5 UTSW 13 100,358,041 (GRCm39) missense probably damaging 1.00
R2333:Naip5 UTSW 13 100,359,679 (GRCm39) missense probably damaging 1.00
R2348:Naip5 UTSW 13 100,356,246 (GRCm39) missense probably benign 0.01
R3055:Naip5 UTSW 13 100,358,386 (GRCm39) missense probably benign 0.23
R3401:Naip5 UTSW 13 100,358,411 (GRCm39) nonsense probably null
R3723:Naip5 UTSW 13 100,359,522 (GRCm39) nonsense probably null
R3775:Naip5 UTSW 13 100,359,902 (GRCm39) missense probably benign 0.00
R3775:Naip5 UTSW 13 100,359,883 (GRCm39) missense probably benign 0.00
R4019:Naip5 UTSW 13 100,359,883 (GRCm39) missense probably benign 0.00
R4019:Naip5 UTSW 13 100,359,902 (GRCm39) missense probably benign 0.00
R4020:Naip5 UTSW 13 100,359,902 (GRCm39) missense probably benign 0.00
R4020:Naip5 UTSW 13 100,359,883 (GRCm39) missense probably benign 0.00
R4074:Naip5 UTSW 13 100,382,572 (GRCm39) missense probably damaging 1.00
R4082:Naip5 UTSW 13 100,382,338 (GRCm39) missense probably damaging 1.00
R4105:Naip5 UTSW 13 100,356,247 (GRCm39) missense probably benign
R4227:Naip5 UTSW 13 100,349,276 (GRCm39) missense probably damaging 0.99
R4639:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R4640:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R4641:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R4644:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R4645:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R4700:Naip5 UTSW 13 100,359,922 (GRCm39) missense possibly damaging 0.62
R4727:Naip5 UTSW 13 100,358,378 (GRCm39) missense possibly damaging 0.81
R4729:Naip5 UTSW 13 100,358,639 (GRCm39) missense possibly damaging 0.75
R4816:Naip5 UTSW 13 100,356,189 (GRCm39) missense probably benign 0.32
R4816:Naip5 UTSW 13 100,356,195 (GRCm39) missense probably benign 0.01
R4816:Naip5 UTSW 13 100,356,204 (GRCm39) missense probably benign 0.00
R4869:Naip5 UTSW 13 100,381,639 (GRCm39) missense probably damaging 1.00
R5162:Naip5 UTSW 13 100,359,914 (GRCm39) missense possibly damaging 0.78
R5244:Naip5 UTSW 13 100,382,170 (GRCm39) missense probably benign 0.08
R5411:Naip5 UTSW 13 100,382,254 (GRCm39) missense possibly damaging 0.54
R5632:Naip5 UTSW 13 100,367,170 (GRCm39) splice site probably null
R5760:Naip5 UTSW 13 100,379,346 (GRCm39) missense probably damaging 1.00
R5916:Naip5 UTSW 13 100,359,209 (GRCm39) missense probably benign 0.02
R6302:Naip5 UTSW 13 100,359,674 (GRCm39) missense possibly damaging 0.76
R6304:Naip5 UTSW 13 100,359,674 (GRCm39) missense possibly damaging 0.76
R6411:Naip5 UTSW 13 100,359,913 (GRCm39) missense probably benign 0.01
R6474:Naip5 UTSW 13 100,351,171 (GRCm39) missense possibly damaging 0.82
R6499:Naip5 UTSW 13 100,358,102 (GRCm39) missense probably benign
R6544:Naip5 UTSW 13 100,359,652 (GRCm39) missense possibly damaging 0.50
R6827:Naip5 UTSW 13 100,382,437 (GRCm39) missense possibly damaging 0.48
R6954:Naip5 UTSW 13 100,359,922 (GRCm39) missense probably damaging 0.99
R7052:Naip5 UTSW 13 100,358,855 (GRCm39) missense probably benign 0.01
R7138:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R7141:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R7375:Naip5 UTSW 13 100,356,204 (GRCm39) missense probably benign 0.00
R7375:Naip5 UTSW 13 100,356,205 (GRCm39) missense not run
R7401:Naip5 UTSW 13 100,356,204 (GRCm39) missense probably benign 0.00
R7401:Naip5 UTSW 13 100,356,205 (GRCm39) missense not run
R7447:Naip5 UTSW 13 100,356,205 (GRCm39) missense not run
R7447:Naip5 UTSW 13 100,356,204 (GRCm39) missense probably benign 0.00
R7466:Naip5 UTSW 13 100,358,494 (GRCm39) nonsense probably null
R7491:Naip5 UTSW 13 100,353,579 (GRCm39) missense probably benign 0.18
R7559:Naip5 UTSW 13 100,356,205 (GRCm39) missense not run
R7559:Naip5 UTSW 13 100,356,204 (GRCm39) missense probably benign 0.00
R7562:Naip5 UTSW 13 100,356,205 (GRCm39) missense not run
R7562:Naip5 UTSW 13 100,356,204 (GRCm39) missense probably benign 0.00
R7588:Naip5 UTSW 13 100,356,205 (GRCm39) missense not run
R7588:Naip5 UTSW 13 100,356,204 (GRCm39) missense probably benign 0.00
R7589:Naip5 UTSW 13 100,356,205 (GRCm39) missense not run
R7589:Naip5 UTSW 13 100,356,204 (GRCm39) missense probably benign 0.00
R7590:Naip5 UTSW 13 100,356,204 (GRCm39) missense probably benign 0.00
R7590:Naip5 UTSW 13 100,356,205 (GRCm39) missense not run
R7742:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R7886:Naip5 UTSW 13 100,382,689 (GRCm39) missense probably benign 0.28
R7996:Naip5 UTSW 13 100,358,164 (GRCm39) missense probably damaging 1.00
R8026:Naip5 UTSW 13 100,382,406 (GRCm39) missense probably damaging 1.00
R8046:Naip5 UTSW 13 100,358,741 (GRCm39) missense probably benign
R8319:Naip5 UTSW 13 100,358,167 (GRCm39) missense probably benign 0.12
R8471:Naip5 UTSW 13 100,358,153 (GRCm39) missense probably damaging 0.99
R8480:Naip5 UTSW 13 100,358,743 (GRCm39) missense probably damaging 1.00
R8496:Naip5 UTSW 13 100,349,247 (GRCm39) missense probably benign 0.00
R8500:Naip5 UTSW 13 100,359,220 (GRCm39) missense probably damaging 0.98
R8712:Naip5 UTSW 13 100,359,604 (GRCm39) missense possibly damaging 0.61
R8780:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R8781:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R8788:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R8817:Naip5 UTSW 13 100,349,207 (GRCm39) missense probably benign 0.01
R8833:Naip5 UTSW 13 100,359,442 (GRCm39) missense probably damaging 0.97
R8835:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R8958:Naip5 UTSW 13 100,354,117 (GRCm39) nonsense probably null
R9031:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R9074:Naip5 UTSW 13 100,358,264 (GRCm39) missense possibly damaging 0.92
R9098:Naip5 UTSW 13 100,366,127 (GRCm39) missense possibly damaging 0.67
R9204:Naip5 UTSW 13 100,359,008 (GRCm39) missense probably damaging 1.00
R9223:Naip5 UTSW 13 100,364,184 (GRCm39) missense probably benign 0.05
R9358:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R9389:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R9403:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R9518:Naip5 UTSW 13 100,358,367 (GRCm39) missense probably benign
R9568:Naip5 UTSW 13 100,359,821 (GRCm39) missense probably benign 0.00
R9568:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R9569:Naip5 UTSW 13 100,359,821 (GRCm39) missense probably benign 0.00
R9569:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R9570:Naip5 UTSW 13 100,359,821 (GRCm39) missense probably benign 0.00
R9572:Naip5 UTSW 13 100,359,821 (GRCm39) missense probably benign 0.00
R9581:Naip5 UTSW 13 100,351,194 (GRCm39) missense probably benign 0.11
R9627:Naip5 UTSW 13 100,356,338 (GRCm39) missense probably benign
R9725:Naip5 UTSW 13 100,358,784 (GRCm39) missense possibly damaging 0.94
R9763:Naip5 UTSW 13 100,367,269 (GRCm39) missense probably damaging 0.99
R9764:Naip5 UTSW 13 100,367,269 (GRCm39) missense probably damaging 0.99
R9765:Naip5 UTSW 13 100,367,269 (GRCm39) missense probably damaging 0.99
Predicted Primers
Posted On 2021-11-19