Incidental Mutation 'R9033:Enam'
ID 687179
Institutional Source Beutler Lab
Gene Symbol Enam
Ensembl Gene ENSMUSG00000029286
Gene Name enamelin
Synonyms abte
MMRRC Submission 068862-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.222) question?
Stock # R9033 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 88635834-88653908 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 88646475 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 259 (R259G)
Ref Sequence ENSEMBL: ENSMUSP00000142854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031222] [ENSMUST00000199104]
AlphaFold O55196
Predicted Effect probably benign
Transcript: ENSMUST00000031222
AA Change: R184G

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000031222
Gene: ENSMUSG00000029286
AA Change: R184G

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
low complexity region 67 114 N/A INTRINSIC
low complexity region 128 150 N/A INTRINSIC
low complexity region 159 167 N/A INTRINSIC
low complexity region 173 187 N/A INTRINSIC
low complexity region 203 214 N/A INTRINSIC
Pfam:Enamelin 216 441 5.4e-74 PFAM
Pfam:Enamelin 503 1249 1.9e-303 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199104
AA Change: R259G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000142854
Gene: ENSMUSG00000029286
AA Change: R259G

DomainStartEndE-ValueType
low complexity region 100 113 N/A INTRINSIC
low complexity region 142 189 N/A INTRINSIC
low complexity region 203 225 N/A INTRINSIC
low complexity region 234 242 N/A INTRINSIC
low complexity region 248 262 N/A INTRINSIC
low complexity region 278 289 N/A INTRINSIC
Pfam:Enamelin 291 510 2.5e-74 PFAM
Pfam:Enamelin 550 1325 N/A PFAM
Meta Mutation Damage Score 0.1024 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 94% (30/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dental enamel forms the outer cap of teeth and is the hardest substance found in vertebrates. This gene encodes the largest protein in the enamel matrix of developing teeth. The protein is involved in the mineralization and structural organization of enamel. Defects in this gene result in amelogenesis imperfect type 1C.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous null mice lack true enamel due to loss of mineralization at the secretory surface of ameloblasts and mandibular incisors are opaque with a rough surface and abnormal wear on the incisal edge. ENU-induced mutant mice provide models for various clinical subtypes of amelogenesis imperfecta. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730049H05Rik G A 6: 92,808,934 (GRCm39) G87D unknown Het
Actg1 T C 11: 120,237,826 (GRCm39) K238R probably benign Het
Arhgef10l G A 4: 140,321,463 (GRCm39) R115C probably damaging Het
Aspm T C 1: 139,405,865 (GRCm39) F1584S probably damaging Het
Atp2b4 C T 1: 133,634,725 (GRCm39) R1168H probably benign Het
Catsper1 G A 19: 5,387,864 (GRCm39) probably null Het
Chgb A C 2: 132,634,914 (GRCm39) K285N probably damaging Het
Csnk1g1 A G 9: 65,915,070 (GRCm39) Y243C probably damaging Het
Dpysl5 G T 5: 30,948,941 (GRCm39) D399Y probably damaging Het
Foxf2 C T 13: 31,810,085 (GRCm39) P8L unknown Het
Fpr1 C T 17: 18,097,691 (GRCm39) W99* probably null Het
Itprid2 A G 2: 79,465,938 (GRCm39) S19G probably damaging Het
Kansl1 A G 11: 104,248,356 (GRCm39) S533P probably benign Het
Klhl25 T A 7: 75,516,681 (GRCm39) M529K probably damaging Het
Mtss2 G A 8: 111,465,651 (GRCm39) R697H probably damaging Het
Nup210l G A 3: 90,105,396 (GRCm39) V1515I probably benign Het
Pcdh15 T C 10: 74,302,138 (GRCm39) F926L probably damaging Het
Pfkfb2 T A 1: 130,626,475 (GRCm39) K433* probably null Het
Pirb G C 7: 3,720,584 (GRCm39) Q305E probably benign Het
Pld5 T C 1: 175,967,585 (GRCm39) D90G probably damaging Het
Rergl T C 6: 139,471,900 (GRCm39) Y83C probably damaging Het
Rorb G A 19: 18,965,422 (GRCm39) probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,229,111 (GRCm39) probably benign Het
Shank2 A G 7: 143,965,236 (GRCm39) Q948R probably damaging Het
Slc4a5 C T 6: 83,237,457 (GRCm39) R147* probably null Het
Tdpoz6 T C 3: 93,600,168 (GRCm39) Y67C probably damaging Het
Tdrd7 G T 4: 46,007,468 (GRCm39) D507Y probably damaging Het
Tspan31 C A 10: 126,904,349 (GRCm39) probably benign Het
Usp40 T C 1: 87,923,499 (GRCm39) probably benign Het
Vmn2r74 A T 7: 85,606,414 (GRCm39) Y311N probably benign Het
Zbtb11 T A 16: 55,818,492 (GRCm39) S639T probably benign Het
Zfp52 T C 17: 21,780,655 (GRCm39) F168L possibly damaging Het
Other mutations in Enam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00769:Enam APN 5 88,649,343 (GRCm39) missense possibly damaging 0.83
IGL01611:Enam APN 5 88,651,608 (GRCm39) missense probably damaging 0.99
IGL01802:Enam APN 5 88,651,533 (GRCm39) missense possibly damaging 0.93
IGL02220:Enam APN 5 88,652,418 (GRCm39) nonsense probably null
IGL02371:Enam APN 5 88,650,668 (GRCm39) missense probably benign 0.39
IGL02596:Enam APN 5 88,650,885 (GRCm39) missense probably benign 0.01
IGL03026:Enam APN 5 88,651,158 (GRCm39) missense probably benign 0.38
IGL03303:Enam APN 5 88,652,450 (GRCm39) missense probably benign 0.12
opinionated UTSW 5 88,650,885 (GRCm39) missense probably benign 0.04
recalcitrant UTSW 5 88,651,650 (GRCm39) nonsense probably null
R0200:Enam UTSW 5 88,640,886 (GRCm39) missense possibly damaging 0.96
R0230:Enam UTSW 5 88,637,514 (GRCm39) splice site probably benign
R0395:Enam UTSW 5 88,649,367 (GRCm39) missense probably damaging 0.99
R0548:Enam UTSW 5 88,650,964 (GRCm39) missense probably damaging 0.96
R0608:Enam UTSW 5 88,640,886 (GRCm39) missense possibly damaging 0.96
R0724:Enam UTSW 5 88,649,853 (GRCm39) missense probably damaging 1.00
R0927:Enam UTSW 5 88,641,919 (GRCm39) missense possibly damaging 0.72
R1023:Enam UTSW 5 88,649,826 (GRCm39) missense probably damaging 0.99
R1053:Enam UTSW 5 88,651,878 (GRCm39) missense possibly damaging 0.64
R1169:Enam UTSW 5 88,651,117 (GRCm39) missense probably damaging 1.00
R1230:Enam UTSW 5 88,641,927 (GRCm39) missense probably damaging 0.99
R1324:Enam UTSW 5 88,641,927 (GRCm39) missense possibly damaging 0.53
R1663:Enam UTSW 5 88,651,853 (GRCm39) missense probably damaging 1.00
R1727:Enam UTSW 5 88,651,853 (GRCm39) missense probably damaging 1.00
R1750:Enam UTSW 5 88,651,086 (GRCm39) missense probably damaging 1.00
R1852:Enam UTSW 5 88,652,324 (GRCm39) missense possibly damaging 0.92
R1907:Enam UTSW 5 88,652,481 (GRCm39) missense possibly damaging 0.86
R2104:Enam UTSW 5 88,649,646 (GRCm39) missense probably damaging 1.00
R2143:Enam UTSW 5 88,640,779 (GRCm39) missense probably benign 0.02
R2196:Enam UTSW 5 88,650,603 (GRCm39) missense probably damaging 0.99
R2363:Enam UTSW 5 88,651,008 (GRCm39) missense probably benign 0.24
R2497:Enam UTSW 5 88,650,553 (GRCm39) missense probably benign 0.13
R3615:Enam UTSW 5 88,652,306 (GRCm39) missense possibly damaging 0.81
R3616:Enam UTSW 5 88,652,306 (GRCm39) missense possibly damaging 0.81
R3782:Enam UTSW 5 88,650,674 (GRCm39) missense probably damaging 1.00
R4067:Enam UTSW 5 88,651,236 (GRCm39) missense probably damaging 1.00
R4349:Enam UTSW 5 88,651,407 (GRCm39) missense probably damaging 0.99
R4604:Enam UTSW 5 88,652,142 (GRCm39) missense possibly damaging 0.93
R4649:Enam UTSW 5 88,640,827 (GRCm39) missense probably benign 0.02
R4702:Enam UTSW 5 88,651,650 (GRCm39) nonsense probably null
R4703:Enam UTSW 5 88,651,650 (GRCm39) nonsense probably null
R4704:Enam UTSW 5 88,651,650 (GRCm39) nonsense probably null
R4705:Enam UTSW 5 88,651,650 (GRCm39) nonsense probably null
R4714:Enam UTSW 5 88,651,395 (GRCm39) missense probably damaging 1.00
R4748:Enam UTSW 5 88,649,402 (GRCm39) missense probably damaging 1.00
R4838:Enam UTSW 5 88,640,967 (GRCm39) nonsense probably null
R4840:Enam UTSW 5 88,650,885 (GRCm39) missense probably benign 0.04
R4856:Enam UTSW 5 88,636,593 (GRCm39) nonsense probably null
R4886:Enam UTSW 5 88,636,593 (GRCm39) nonsense probably null
R4910:Enam UTSW 5 88,650,173 (GRCm39) missense probably benign
R4911:Enam UTSW 5 88,650,173 (GRCm39) missense probably benign
R6103:Enam UTSW 5 88,650,187 (GRCm39) missense probably damaging 0.96
R6651:Enam UTSW 5 88,650,776 (GRCm39) missense probably damaging 0.98
R6759:Enam UTSW 5 88,649,550 (GRCm39) missense probably damaging 1.00
R7282:Enam UTSW 5 88,650,186 (GRCm39) missense probably damaging 0.99
R7365:Enam UTSW 5 88,649,347 (GRCm39) missense possibly damaging 0.75
R7392:Enam UTSW 5 88,649,523 (GRCm39) missense probably damaging 0.99
R7483:Enam UTSW 5 88,649,679 (GRCm39) missense probably damaging 1.00
R7647:Enam UTSW 5 88,650,884 (GRCm39) missense probably benign 0.00
R7648:Enam UTSW 5 88,652,016 (GRCm39) missense possibly damaging 0.89
R7672:Enam UTSW 5 88,651,830 (GRCm39) missense possibly damaging 0.80
R7943:Enam UTSW 5 88,636,410 (GRCm39) splice site probably null
R7999:Enam UTSW 5 88,651,561 (GRCm39) missense probably benign
R8117:Enam UTSW 5 88,651,385 (GRCm39) missense probably benign 0.00
R8419:Enam UTSW 5 88,651,209 (GRCm39) missense possibly damaging 0.80
R8528:Enam UTSW 5 88,650,078 (GRCm39) missense probably damaging 0.98
R8836:Enam UTSW 5 88,639,124 (GRCm39) critical splice donor site probably null
R8973:Enam UTSW 5 88,641,947 (GRCm39) missense possibly damaging 0.96
R9001:Enam UTSW 5 88,637,388 (GRCm39) missense probably benign 0.11
R9268:Enam UTSW 5 88,640,778 (GRCm39) missense probably benign 0.01
R9723:Enam UTSW 5 88,652,241 (GRCm39) missense probably damaging 1.00
X0018:Enam UTSW 5 88,650,550 (GRCm39) nonsense probably null
Z1176:Enam UTSW 5 88,640,830 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGCAACATAGAAAGTGCTTTCC -3'
(R):5'- TTGAGAGCTCGAGTTAAAGACG -3'

Sequencing Primer
(F):5'- AGTCCAGTCTAATGGTGCAC -3'
(R):5'- GAGCTCGAGTTAAAGACGTTTTTAGC -3'
Posted On 2021-11-19