Incidental Mutation 'R9033:Rergl'
ID 687182
Institutional Source Beutler Lab
Gene Symbol Rergl
Ensembl Gene ENSMUSG00000092164
Gene Name RERG/RAS-like
Synonyms EG632971
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock # R9033 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 139492973-139501976 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 139494902 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 83 (Y83C)
Ref Sequence ENSEMBL: ENSMUSP00000131303 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170650]
AlphaFold B2RVE2
Predicted Effect probably damaging
Transcript: ENSMUST00000170650
AA Change: Y83C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131303
Gene: ENSMUSG00000092164
AA Change: Y83C

DomainStartEndE-ValueType
Pfam:Ras 5 173 7.7e-30 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 94% (30/32)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730049H05Rik G A 6: 92,831,953 G87D unknown Het
Actg1 T C 11: 120,347,000 K238R probably benign Het
Arhgef10l G A 4: 140,594,152 R115C probably damaging Het
Aspm T C 1: 139,478,127 F1584S probably damaging Het
Atp2b4 C T 1: 133,706,987 R1168H probably benign Het
Catsper1 G A 19: 5,337,836 probably null Het
Chgb A C 2: 132,792,994 K285N probably damaging Het
Csnk1g1 A G 9: 66,007,788 Y243C probably damaging Het
Dpysl5 G T 5: 30,791,597 D399Y probably damaging Het
Enam A G 5: 88,498,616 R259G probably benign Het
Foxf2 C T 13: 31,626,102 P8L unknown Het
Fpr1 C T 17: 17,877,429 W99* probably null Het
Gm37596 T C 3: 93,692,861 Y67C probably damaging Het
Kansl1 A G 11: 104,357,530 S533P probably benign Het
Klhl25 T A 7: 75,866,933 M529K probably damaging Het
Mtss1l G A 8: 110,739,019 R697H probably damaging Het
Nup210l G A 3: 90,198,089 V1515I probably benign Het
Pcdh15 T C 10: 74,466,306 F926L probably damaging Het
Pfkfb2 T A 1: 130,698,738 K433* probably null Het
Pirb G C 7: 3,717,585 Q305E probably benign Het
Pld5 T C 1: 176,140,019 D90G probably damaging Het
Rorb G A 19: 18,988,058 probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Shank2 A G 7: 144,411,499 Q948R probably damaging Het
Slc4a5 C T 6: 83,260,475 R147* probably null Het
Ssfa2 A G 2: 79,635,594 S19G probably damaging Het
Tdrd7 G T 4: 46,007,468 D507Y probably damaging Het
Tspan31 C A 10: 127,068,480 probably benign Het
Usp40 T C 1: 87,995,777 probably benign Het
Vmn2r74 A T 7: 85,957,206 Y311N probably benign Het
Zbtb11 T A 16: 55,998,129 S639T probably benign Het
Zfp52 T C 17: 21,560,393 F168L possibly damaging Het
Other mutations in Rergl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Rergl APN 6 139493258 nonsense probably null
IGL01542:Rergl APN 6 139493498 critical splice acceptor site probably null
IGL01761:Rergl APN 6 139501865 missense probably damaging 0.96
IGL02236:Rergl APN 6 139494920 missense probably benign 0.25
IGL02507:Rergl APN 6 139493353 missense probably damaging 1.00
IGL02523:Rergl APN 6 139496460 splice site probably benign
R0518:Rergl UTSW 6 139496526 missense probably damaging 1.00
R0521:Rergl UTSW 6 139496526 missense probably damaging 1.00
R2086:Rergl UTSW 6 139494834 missense probably benign
R4629:Rergl UTSW 6 139501852 missense probably damaging 1.00
R5275:Rergl UTSW 6 139501821 critical splice donor site probably null
R6364:Rergl UTSW 6 139500748 missense probably damaging 1.00
R7175:Rergl UTSW 6 139496535 missense probably benign 0.01
R8808:Rergl UTSW 6 139501867 missense probably benign 0.18
R9403:Rergl UTSW 6 139494854 missense possibly damaging 0.79
Z1088:Rergl UTSW 6 139493426 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTCGTGAGTGTCATGTTAACAATAGC -3'
(R):5'- TCGTCCAAGAAAGACAGTGATG -3'

Sequencing Primer
(F):5'- GTCAGCCAGGGTATAAAGCATTCTC -3'
(R):5'- TCCAAGAAAGACAGTGATGAGAAAG -3'
Posted On 2021-11-19