Incidental Mutation 'R9033:Rergl'
ID 687182
Institutional Source Beutler Lab
Gene Symbol Rergl
Ensembl Gene ENSMUSG00000092164
Gene Name RERG/RAS-like
Synonyms EG632971
MMRRC Submission 068862-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.074) question?
Stock # R9033 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 139470180-139478907 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 139471900 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 83 (Y83C)
Ref Sequence ENSEMBL: ENSMUSP00000131303 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170650]
AlphaFold B2RVE2
Predicted Effect probably damaging
Transcript: ENSMUST00000170650
AA Change: Y83C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131303
Gene: ENSMUSG00000092164
AA Change: Y83C

DomainStartEndE-ValueType
Pfam:Ras 5 173 7.7e-30 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 94% (30/32)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730049H05Rik G A 6: 92,808,934 (GRCm39) G87D unknown Het
Actg1 T C 11: 120,237,826 (GRCm39) K238R probably benign Het
Arhgef10l G A 4: 140,321,463 (GRCm39) R115C probably damaging Het
Aspm T C 1: 139,405,865 (GRCm39) F1584S probably damaging Het
Atp2b4 C T 1: 133,634,725 (GRCm39) R1168H probably benign Het
Catsper1 G A 19: 5,387,864 (GRCm39) probably null Het
Chgb A C 2: 132,634,914 (GRCm39) K285N probably damaging Het
Csnk1g1 A G 9: 65,915,070 (GRCm39) Y243C probably damaging Het
Dpysl5 G T 5: 30,948,941 (GRCm39) D399Y probably damaging Het
Enam A G 5: 88,646,475 (GRCm39) R259G probably benign Het
Foxf2 C T 13: 31,810,085 (GRCm39) P8L unknown Het
Fpr1 C T 17: 18,097,691 (GRCm39) W99* probably null Het
Itprid2 A G 2: 79,465,938 (GRCm39) S19G probably damaging Het
Kansl1 A G 11: 104,248,356 (GRCm39) S533P probably benign Het
Klhl25 T A 7: 75,516,681 (GRCm39) M529K probably damaging Het
Mtss2 G A 8: 111,465,651 (GRCm39) R697H probably damaging Het
Nup210l G A 3: 90,105,396 (GRCm39) V1515I probably benign Het
Pcdh15 T C 10: 74,302,138 (GRCm39) F926L probably damaging Het
Pfkfb2 T A 1: 130,626,475 (GRCm39) K433* probably null Het
Pirb G C 7: 3,720,584 (GRCm39) Q305E probably benign Het
Pld5 T C 1: 175,967,585 (GRCm39) D90G probably damaging Het
Rorb G A 19: 18,965,422 (GRCm39) probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,229,111 (GRCm39) probably benign Het
Shank2 A G 7: 143,965,236 (GRCm39) Q948R probably damaging Het
Slc4a5 C T 6: 83,237,457 (GRCm39) R147* probably null Het
Tdpoz6 T C 3: 93,600,168 (GRCm39) Y67C probably damaging Het
Tdrd7 G T 4: 46,007,468 (GRCm39) D507Y probably damaging Het
Tspan31 C A 10: 126,904,349 (GRCm39) probably benign Het
Usp40 T C 1: 87,923,499 (GRCm39) probably benign Het
Vmn2r74 A T 7: 85,606,414 (GRCm39) Y311N probably benign Het
Zbtb11 T A 16: 55,818,492 (GRCm39) S639T probably benign Het
Zfp52 T C 17: 21,780,655 (GRCm39) F168L possibly damaging Het
Other mutations in Rergl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Rergl APN 6 139,470,256 (GRCm39) nonsense probably null
IGL01542:Rergl APN 6 139,470,496 (GRCm39) critical splice acceptor site probably null
IGL01761:Rergl APN 6 139,478,863 (GRCm39) missense probably damaging 0.96
IGL02236:Rergl APN 6 139,471,918 (GRCm39) missense probably benign 0.25
IGL02507:Rergl APN 6 139,470,351 (GRCm39) missense probably damaging 1.00
IGL02523:Rergl APN 6 139,473,458 (GRCm39) splice site probably benign
R0518:Rergl UTSW 6 139,473,524 (GRCm39) missense probably damaging 1.00
R0521:Rergl UTSW 6 139,473,524 (GRCm39) missense probably damaging 1.00
R2086:Rergl UTSW 6 139,471,832 (GRCm39) missense probably benign
R4629:Rergl UTSW 6 139,478,850 (GRCm39) missense probably damaging 1.00
R5275:Rergl UTSW 6 139,478,819 (GRCm39) critical splice donor site probably null
R6364:Rergl UTSW 6 139,477,746 (GRCm39) missense probably damaging 1.00
R7175:Rergl UTSW 6 139,473,533 (GRCm39) missense probably benign 0.01
R8808:Rergl UTSW 6 139,478,865 (GRCm39) missense probably benign 0.18
R9403:Rergl UTSW 6 139,471,852 (GRCm39) missense possibly damaging 0.79
R9803:Rergl UTSW 6 139,477,761 (GRCm39) missense probably damaging 1.00
Z1088:Rergl UTSW 6 139,470,424 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTCGTGAGTGTCATGTTAACAATAGC -3'
(R):5'- TCGTCCAAGAAAGACAGTGATG -3'

Sequencing Primer
(F):5'- GTCAGCCAGGGTATAAAGCATTCTC -3'
(R):5'- TCCAAGAAAGACAGTGATGAGAAAG -3'
Posted On 2021-11-19