Incidental Mutation 'R9034:H2-M2'
ID 687258
Institutional Source Beutler Lab
Gene Symbol H2-M2
Ensembl Gene ENSMUSG00000016283
Gene Name histocompatibility 2, M region locus 2
Synonyms Thy19.4, H-2M2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock # R9034 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 37480851-37483552 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 37481285 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 325 (S325T)
Ref Sequence ENSEMBL: ENSMUSP00000131297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016427] [ENSMUST00000171139]
AlphaFold Q6W9L1
Predicted Effect probably benign
Transcript: ENSMUST00000016427
SMART Domains Protein: ENSMUSP00000016427
Gene: ENSMUSG00000016283

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:MHC_I 29 207 1.6e-77 PFAM
IGc1 226 297 2.11e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171139
AA Change: S325T

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000131297
Gene: ENSMUSG00000016283
AA Change: S325T

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:MHC_I 29 207 7.1e-76 PFAM
IGc1 226 297 2.11e-20 SMART
transmembrane domain 308 330 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik C T 8: 36,511,800 R186* probably null Het
Abca9 T C 11: 110,148,789 D466G probably benign Het
Acvr2a T C 2: 48,873,369 Y142H probably damaging Het
Agfg1 C T 1: 82,876,192 Q188* probably null Het
Akap11 C A 14: 78,510,859 V1363F Het
Aldh3a1 A G 11: 61,213,649 T121A probably benign Het
Arid1b T A 17: 5,336,905 D1491E probably benign Het
Baz2a A G 10: 128,116,399 T617A probably damaging Het
Cacna1c T C 6: 118,751,398 M362V Het
Cant1 T A 11: 118,411,302 H63L probably benign Het
Cdkn2aip C A 8: 47,711,208 C490F probably damaging Het
Cenpn T A 8: 116,934,739 D192E probably benign Het
Clint1 C A 11: 45,908,955 L514M probably benign Het
Clint1 T A 11: 45,908,956 L514Q possibly damaging Het
Cmklr1 G C 5: 113,613,982 H319Q probably benign Het
Cspg5 T C 9: 110,251,021 F419S probably damaging Het
Ehmt2 C A 17: 34,903,441 A328E probably benign Het
Ercc6l2 T C 13: 63,844,633 S299P probably damaging Het
F13b T C 1: 139,508,223 C256R probably damaging Het
F830016B08Rik A G 18: 60,300,069 T75A probably damaging Het
Fam227a T C 15: 79,648,751 M69V probably benign Het
Gm40460 GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG 7: 142,240,434 probably benign Het
Grin2c C T 11: 115,251,239 E785K probably damaging Het
Hmgcr A G 13: 96,659,377 S261P probably damaging Het
Impg1 T A 9: 80,465,298 probably benign Het
Krtap26-1 A T 16: 88,647,273 N153K probably benign Het
Lrmp T C 6: 145,137,547 V4A probably benign Het
Mfsd14b G T 13: 65,075,686 A178E probably damaging Het
Muc4 CAC CACTAC 16: 32,754,076 probably benign Het
Myh6 A T 14: 54,948,139 I1531N possibly damaging Het
Myo7a G T 7: 98,079,258 A836D probably benign Het
Ncam1 A T 9: 49,569,898 S19T probably benign Het
Nes T A 3: 87,978,428 D1331E probably damaging Het
Nsd2 G A 5: 33,880,134 R700Q possibly damaging Het
Nxt1 A T 2: 148,675,411 Y24F possibly damaging Het
Olfr1001-ps1 A T 2: 85,633,800 T124S probably benign Het
Olfr1016 G T 2: 85,799,958 A104E possibly damaging Het
Olfr150 G A 9: 39,737,590 M258I probably benign Het
Olfr292 G A 7: 86,694,761 V102I probably benign Het
Olfr523 G A 7: 140,176,971 V284I probably benign Het
Olfr658 T A 7: 104,644,628 H248L probably damaging Het
Olfr889 G A 9: 38,116,254 V158M possibly damaging Het
Pex5l T A 3: 32,952,534 Q562L probably damaging Het
Plxna2 A G 1: 194,793,889 Y1139C probably damaging Het
Prelp T C 1: 133,914,591 N272S probably damaging Het
Rtkn2 A G 10: 68,005,586 K188R probably damaging Het
Sbno2 G A 10: 80,062,757 R624W probably damaging Het
Scn8a T A 15: 101,029,761 C1374S probably damaging Het
Serpina1e T A 12: 103,951,102 T103S probably benign Het
Sh3tc2 A G 18: 61,974,500 E194G probably benign Het
Slc36a3 A T 11: 55,125,689 I360N probably damaging Het
Sphk1 T C 11: 116,535,623 V135A probably damaging Het
Tnfsf10 G A 3: 27,335,230 D147N probably benign Het
Tnip2 C T 5: 34,513,833 C22Y probably damaging Het
Trp73 T C 4: 154,067,631 T187A probably benign Het
Tspan33 C T 6: 29,717,612 Q276* probably null Het
Ttn C T 2: 76,712,527 G33372R probably damaging Het
Vmn2r31 T A 7: 7,394,681 T193S probably benign Het
Vps54 T C 11: 21,263,273 F19L probably benign Het
Vwa8 A G 14: 79,058,739 T856A probably damaging Het
Zscan4b A T 7: 10,900,913 Y468N probably benign Het
Other mutations in H2-M2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01683:H2-M2 APN 17 37481515 missense possibly damaging 0.95
Lock UTSW 17 37481508 missense probably damaging 1.00
Nokia UTSW 17 37481306 missense possibly damaging 0.59
R0799:H2-M2 UTSW 17 37482749 missense probably damaging 1.00
R0981:H2-M2 UTSW 17 37482630 missense probably benign 0.02
R1925:H2-M2 UTSW 17 37482500 missense probably damaging 0.98
R2959:H2-M2 UTSW 17 37483454 missense probably benign 0.20
R3968:H2-M2 UTSW 17 37481306 missense possibly damaging 0.59
R4063:H2-M2 UTSW 17 37481508 missense probably damaging 1.00
R4735:H2-M2 UTSW 17 37483244 missense possibly damaging 0.91
R5806:H2-M2 UTSW 17 37481726 missense probably damaging 1.00
R6410:H2-M2 UTSW 17 37483213 missense probably damaging 1.00
R7432:H2-M2 UTSW 17 37481470 critical splice donor site probably null
R7456:H2-M2 UTSW 17 37481661 missense possibly damaging 0.60
R7535:H2-M2 UTSW 17 37482637 missense probably benign 0.07
R7680:H2-M2 UTSW 17 37483025 missense possibly damaging 0.56
R8112:H2-M2 UTSW 17 37483492 missense unknown
R8910:H2-M2 UTSW 17 37481522 missense probably damaging 1.00
R9193:H2-M2 UTSW 17 37482537 missense probably benign 0.00
R9420:H2-M2 UTSW 17 37481324 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- CTGAGTTCATACAGAGACCCCTC -3'
(R):5'- CATAGCCTGTGGTTAGAGAAGG -3'

Sequencing Primer
(F):5'- TTCTTGTGTGTGTGTATAAATATCCC -3'
(R):5'- GCAAAAGCCTTTCTGGAGATCCTG -3'
Posted On 2021-11-19