Incidental Mutation 'R9035:Cenpe'
ID 687283
Institutional Source Beutler Lab
Gene Symbol Cenpe
Ensembl Gene ENSMUSG00000045328
Gene Name centromere protein E
Synonyms 312kDa, Kif10, N-7 kinesin, CENP-E
MMRRC Submission 068864-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9035 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 134918324-134979301 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 134976572 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 2393 (N2393S)
Ref Sequence ENSEMBL: ENSMUSP00000057938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062893]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000062893
AA Change: N2393S

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000057938
Gene: ENSMUSG00000045328
AA Change: N2393S

DomainStartEndE-ValueType
KISc 4 337 2.4e-172 SMART
coiled coil region 493 612 N/A INTRINSIC
coiled coil region 637 752 N/A INTRINSIC
internal_repeat_1 768 801 3.5e-5 PROSPERO
coiled coil region 821 991 N/A INTRINSIC
low complexity region 1119 1143 N/A INTRINSIC
internal_repeat_2 1225 1238 6.26e-5 PROSPERO
low complexity region 1446 1467 N/A INTRINSIC
low complexity region 1480 1498 N/A INTRINSIC
internal_repeat_2 1614 1627 6.26e-5 PROSPERO
internal_repeat_1 2018 2051 3.5e-5 PROSPERO
coiled coil region 2226 2247 N/A INTRINSIC
coiled coil region 2316 2363 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 99% (90/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Centrosome-associated protein E (CENPE) is a kinesin-like motor protein that accumulates in the G2 phase of the cell cycle. Unlike other centrosome-associated proteins, it is not present during interphase and first appears at the centromere region of chromosomes during prometaphase. This protein is required for stable spindle microtubule capture at kinetochores which is a necessary step in chromosome alignment during prometaphase. This protein also couples chromosome position to microtubule depolymerizing activity. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for a knock-out allele display early embryonic lethality. Mutant embryos grown in culture exhibit inner cell mass growth defects and mitotic chromosome misalignment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A G 11: 110,021,461 (GRCm39) L1083P probably damaging Het
Anxa7 G T 14: 20,510,460 (GRCm39) T356K probably damaging Het
Atg16l1 T C 1: 87,693,167 (GRCm39) probably null Het
Bptf A G 11: 106,963,842 (GRCm39) V1784A probably damaging Het
Cabs1 T C 5: 88,128,309 (GRCm39) V320A probably damaging Het
Camta1 A C 4: 151,229,159 (GRCm39) S558A probably benign Het
Ccdc180 A T 4: 45,906,922 (GRCm39) K466* probably null Het
Cdhr1 G A 14: 36,810,924 (GRCm39) P279L possibly damaging Het
Cep104 T C 4: 154,063,462 (GRCm39) V8A probably benign Het
Chaf1a T A 17: 56,371,110 (GRCm39) V665E probably damaging Het
Clasp1 T A 1: 118,431,583 (GRCm39) D404E probably damaging Het
Clnk G A 5: 38,907,751 (GRCm39) T169I possibly damaging Het
Cnst G A 1: 179,437,587 (GRCm39) A384T possibly damaging Het
Ctnnd2 T A 15: 30,332,162 (GRCm39) M15K possibly damaging Het
Dlgap1 T A 17: 70,823,855 (GRCm39) L280Q possibly damaging Het
Dll1 T C 17: 15,588,959 (GRCm39) K572R probably benign Het
Dnai4 T A 4: 102,905,499 (GRCm39) K761* probably null Het
Dolk C A 2: 30,174,542 (GRCm39) W501L probably damaging Het
Ednrb G A 14: 104,080,665 (GRCm39) P83L probably benign Het
Edrf1 T C 7: 133,245,431 (GRCm39) W190R probably damaging Het
Epha5 T A 5: 84,255,886 (GRCm39) D468V probably damaging Het
Fat2 G T 11: 55,194,547 (GRCm39) P1164Q probably damaging Het
Fbln5 A T 12: 101,717,041 (GRCm39) V436E probably damaging Het
Fbxw10 G T 11: 62,758,449 (GRCm39) R558L possibly damaging Het
Fhod3 C A 18: 25,161,140 (GRCm39) S557R probably benign Het
Gmip A T 8: 70,273,298 (GRCm39) H863L probably damaging Het
Grm3 A T 5: 9,620,464 (GRCm39) I260N probably damaging Het
Gtpbp8 G A 16: 44,566,511 (GRCm39) P64S probably benign Het
Hand1 A C 11: 57,722,548 (GRCm39) M22R probably benign Het
Ift70b T C 2: 75,767,596 (GRCm39) T386A probably benign Het
Igsf21 A G 4: 139,884,782 (GRCm39) V58A probably damaging Het
Ikzf2 G A 1: 69,578,637 (GRCm39) R291* probably null Het
Itih4 C G 14: 30,618,650 (GRCm39) P687R probably benign Het
Kifc3 C T 8: 95,853,195 (GRCm39) D54N possibly damaging Het
Kmt2c G T 5: 25,524,010 (GRCm39) Q1739K probably damaging Het
Krtap4-1 G T 11: 99,518,708 (GRCm39) R101S unknown Het
L3mbtl2 T A 15: 81,560,744 (GRCm39) probably benign Het
Lcor A T 19: 41,573,399 (GRCm39) H718L probably benign Het
Lrrc73 T C 17: 46,565,293 (GRCm39) I8T probably damaging Het
Med19 C A 2: 84,516,532 (GRCm39) probably benign Het
Mgarp C T 3: 51,296,264 (GRCm39) S246N unknown Het
Mkrn2 T C 6: 115,594,681 (GRCm39) S414P possibly damaging Het
Mucl2 C T 15: 103,926,279 (GRCm39) R137H unknown Het
Myo1g A G 11: 6,464,916 (GRCm39) Y453H probably damaging Het
Nacc2 C A 2: 25,951,605 (GRCm39) R410L probably damaging Het
Ndufs3 C T 2: 90,725,217 (GRCm39) R210H probably damaging Het
Nlgn1 G T 3: 25,488,595 (GRCm39) T580K probably damaging Het
Nobox A T 6: 43,284,522 (GRCm39) D41E probably damaging Het
Nsd1 A G 13: 55,393,667 (GRCm39) R526G possibly damaging Het
Nt5e A G 9: 88,246,873 (GRCm39) M370V probably benign Het
Olfm5 T A 7: 103,803,099 (GRCm39) N455Y probably damaging Het
Or2g7 T C 17: 38,378,179 (GRCm39) V39A probably benign Het
Or4c101 T A 2: 88,389,863 (GRCm39) F6I probably damaging Het
Or52e19 T C 7: 102,959,186 (GRCm39) I86T probably damaging Het
Or8g50 G A 9: 39,648,886 (GRCm39) M258I probably benign Het
Or8k33 T A 2: 86,384,021 (GRCm39) Y149F probably damaging Het
Pcdhac2 T C 18: 37,277,758 (GRCm39) V246A probably damaging Het
Pclo A T 5: 14,763,192 (GRCm39) Q603H Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 110,350,827 (GRCm39) probably benign Het
Pkhd1 T A 1: 20,573,176 (GRCm39) Q1910L probably damaging Het
Plg C A 17: 12,609,107 (GRCm39) Y137* probably null Het
Prkra T C 2: 76,460,856 (GRCm39) I281V probably benign Het
Prrc2c A C 1: 162,503,295 (GRCm39) L2722R possibly damaging Het
Prss12 A G 3: 123,279,149 (GRCm39) T409A probably damaging Het
Rnaseh1 A G 12: 28,708,290 (GRCm39) Q256R probably benign Het
Rpp14 T A 14: 8,083,772 (GRCm38) Y17N possibly damaging Het
Ryr1 A T 7: 28,790,422 (GRCm39) H1468Q probably damaging Het
Scp2 C T 4: 107,912,717 (GRCm39) V463M probably damaging Het
Sf3b4 C A 3: 96,080,381 (GRCm39) H43Q probably damaging Het
Sgpp1 T C 12: 75,782,238 (GRCm39) S34G probably benign Het
Shisa9 T A 16: 11,802,902 (GRCm39) I153N probably damaging Het
Sin3b C A 8: 73,450,092 (GRCm39) P3H unknown Het
Slc15a2 C A 16: 36,602,719 (GRCm39) K47N possibly damaging Het
Slc30a6 T A 17: 74,726,586 (GRCm39) F297L probably benign Het
Slc45a3 TGGGG TGGGGG 1: 131,909,187 (GRCm39) probably null Het
Slfn4 A T 11: 83,077,476 (GRCm39) D88V probably benign Het
Tgs1 C A 4: 3,593,491 (GRCm39) Q460K probably benign Het
Tlr11 A T 14: 50,598,434 (GRCm39) D140V probably benign Het
Tmem215 T A 4: 40,473,945 (GRCm39) N7K probably damaging Het
Tmem245 T C 4: 56,922,384 (GRCm39) probably benign Het
Tnfsf10 G A 3: 27,389,379 (GRCm39) D147N probably benign Het
Tpm1 A G 9: 66,955,138 (GRCm39) L57P possibly damaging Het
Trappc10 T C 10: 78,043,723 (GRCm39) probably benign Het
Trmt9b C T 8: 36,978,954 (GRCm39) R186* probably null Het
Ttn T C 2: 76,593,061 (GRCm39) T20730A possibly damaging Het
Uap1 A T 1: 169,977,013 (GRCm39) Y395* probably null Het
Usp2 A T 9: 43,987,176 (GRCm39) D158V probably damaging Het
Usp30 A G 5: 114,243,877 (GRCm39) M149V probably benign Het
Vmn2r2 T C 3: 64,024,172 (GRCm39) N803S probably damaging Het
Vmn2r85 A G 10: 130,261,479 (GRCm39) V286A probably benign Het
Xdh T C 17: 74,217,222 (GRCm39) H682R probably benign Het
Zbed3 T A 13: 95,472,999 (GRCm39) L141Q probably damaging Het
Zfp623 T C 15: 75,820,162 (GRCm39) C373R possibly damaging Het
Other mutations in Cenpe
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00655:Cenpe APN 3 134,937,216 (GRCm39) critical splice donor site probably null
IGL00799:Cenpe APN 3 134,934,678 (GRCm39) critical splice donor site probably null
IGL00815:Cenpe APN 3 134,965,112 (GRCm39) missense probably benign
IGL01446:Cenpe APN 3 134,943,300 (GRCm39) missense probably benign 0.01
IGL01469:Cenpe APN 3 134,934,567 (GRCm39) missense probably damaging 1.00
IGL01843:Cenpe APN 3 134,924,268 (GRCm39) missense possibly damaging 0.88
IGL02254:Cenpe APN 3 134,961,238 (GRCm39) missense probably benign
IGL02337:Cenpe APN 3 134,926,037 (GRCm39) splice site probably benign
IGL02382:Cenpe APN 3 134,953,147 (GRCm39) missense probably benign
IGL02458:Cenpe APN 3 134,935,869 (GRCm39) nonsense probably null
IGL02934:Cenpe APN 3 134,970,112 (GRCm39) missense probably damaging 1.00
IGL03335:Cenpe APN 3 134,949,386 (GRCm39) missense probably benign
R0086:Cenpe UTSW 3 134,970,185 (GRCm39) splice site probably benign
R0173:Cenpe UTSW 3 134,965,744 (GRCm39) missense probably benign 0.00
R0394:Cenpe UTSW 3 134,922,186 (GRCm39) splice site probably benign
R0411:Cenpe UTSW 3 134,928,016 (GRCm39) missense probably damaging 1.00
R0624:Cenpe UTSW 3 134,952,347 (GRCm39) missense probably benign 0.00
R0634:Cenpe UTSW 3 134,952,588 (GRCm39) missense probably damaging 1.00
R0648:Cenpe UTSW 3 134,935,843 (GRCm39) missense probably damaging 1.00
R0691:Cenpe UTSW 3 134,923,066 (GRCm39) missense probably damaging 1.00
R1184:Cenpe UTSW 3 134,970,183 (GRCm39) critical splice donor site probably null
R1530:Cenpe UTSW 3 134,952,663 (GRCm39) missense possibly damaging 0.92
R1559:Cenpe UTSW 3 134,976,661 (GRCm39) missense probably benign 0.07
R1562:Cenpe UTSW 3 134,944,155 (GRCm39) missense possibly damaging 0.53
R1568:Cenpe UTSW 3 134,945,519 (GRCm39) missense probably benign 0.01
R1712:Cenpe UTSW 3 134,971,694 (GRCm39) missense probably damaging 0.99
R1828:Cenpe UTSW 3 134,952,257 (GRCm39) missense probably damaging 0.99
R1846:Cenpe UTSW 3 134,945,606 (GRCm39) missense probably damaging 1.00
R1861:Cenpe UTSW 3 134,974,740 (GRCm39) missense probably damaging 1.00
R1938:Cenpe UTSW 3 134,953,240 (GRCm39) missense probably damaging 0.98
R1961:Cenpe UTSW 3 134,948,254 (GRCm39) missense probably damaging 1.00
R2062:Cenpe UTSW 3 134,928,082 (GRCm39) splice site probably benign
R2118:Cenpe UTSW 3 134,952,645 (GRCm39) missense possibly damaging 0.94
R2127:Cenpe UTSW 3 134,945,541 (GRCm39) missense probably benign 0.08
R2156:Cenpe UTSW 3 134,953,235 (GRCm39) missense probably benign 0.34
R2265:Cenpe UTSW 3 134,967,397 (GRCm39) missense probably benign 0.02
R2268:Cenpe UTSW 3 134,967,397 (GRCm39) missense probably benign 0.02
R2392:Cenpe UTSW 3 134,953,874 (GRCm39) missense probably damaging 1.00
R2508:Cenpe UTSW 3 134,946,834 (GRCm39) missense possibly damaging 0.92
R3084:Cenpe UTSW 3 134,946,782 (GRCm39) missense probably damaging 1.00
R3779:Cenpe UTSW 3 134,962,337 (GRCm39) missense possibly damaging 0.87
R3833:Cenpe UTSW 3 134,928,083 (GRCm39) splice site probably benign
R3974:Cenpe UTSW 3 134,940,986 (GRCm39) splice site probably null
R3975:Cenpe UTSW 3 134,944,233 (GRCm39) critical splice donor site probably null
R3975:Cenpe UTSW 3 134,940,986 (GRCm39) splice site probably null
R4151:Cenpe UTSW 3 134,920,914 (GRCm39) missense probably benign 0.36
R4166:Cenpe UTSW 3 134,949,479 (GRCm39) missense probably damaging 1.00
R4581:Cenpe UTSW 3 134,952,761 (GRCm39) missense probably benign 0.30
R4622:Cenpe UTSW 3 134,949,469 (GRCm39) missense probably benign 0.22
R4692:Cenpe UTSW 3 134,922,140 (GRCm39) missense probably benign 0.29
R4769:Cenpe UTSW 3 134,953,912 (GRCm39) missense probably benign
R4976:Cenpe UTSW 3 134,940,637 (GRCm39) missense probably damaging 1.00
R4983:Cenpe UTSW 3 134,940,689 (GRCm39) missense probably damaging 1.00
R4990:Cenpe UTSW 3 134,962,401 (GRCm39) missense probably damaging 1.00
R5002:Cenpe UTSW 3 134,952,842 (GRCm39) missense probably benign
R5057:Cenpe UTSW 3 134,926,074 (GRCm39) missense probably benign 0.14
R5063:Cenpe UTSW 3 134,976,715 (GRCm39) missense probably damaging 0.99
R5181:Cenpe UTSW 3 134,948,064 (GRCm39) missense probably damaging 0.99
R5281:Cenpe UTSW 3 134,935,911 (GRCm39) missense possibly damaging 0.89
R5389:Cenpe UTSW 3 134,965,149 (GRCm39) critical splice donor site probably null
R5517:Cenpe UTSW 3 134,929,026 (GRCm39) missense probably damaging 1.00
R5521:Cenpe UTSW 3 134,974,826 (GRCm39) missense probably damaging 1.00
R5607:Cenpe UTSW 3 134,940,837 (GRCm39) nonsense probably null
R5608:Cenpe UTSW 3 134,940,837 (GRCm39) nonsense probably null
R5627:Cenpe UTSW 3 134,941,234 (GRCm39) missense possibly damaging 0.51
R5766:Cenpe UTSW 3 134,954,174 (GRCm39) missense probably damaging 0.96
R5783:Cenpe UTSW 3 134,967,341 (GRCm39) missense probably benign 0.00
R5933:Cenpe UTSW 3 134,967,389 (GRCm39) missense probably benign 0.03
R6073:Cenpe UTSW 3 134,965,834 (GRCm39) nonsense probably null
R6163:Cenpe UTSW 3 134,974,764 (GRCm39) missense probably damaging 0.99
R6192:Cenpe UTSW 3 134,954,291 (GRCm39) missense possibly damaging 0.93
R6224:Cenpe UTSW 3 134,949,536 (GRCm39) missense possibly damaging 0.87
R6313:Cenpe UTSW 3 134,935,936 (GRCm39) missense probably benign 0.26
R6326:Cenpe UTSW 3 134,945,539 (GRCm39) missense probably benign 0.15
R6383:Cenpe UTSW 3 134,957,289 (GRCm39) missense probably damaging 1.00
R6418:Cenpe UTSW 3 134,957,305 (GRCm39) missense probably damaging 0.99
R6797:Cenpe UTSW 3 134,943,899 (GRCm39) missense possibly damaging 0.92
R6810:Cenpe UTSW 3 134,949,583 (GRCm39) missense probably benign 0.00
R6989:Cenpe UTSW 3 134,940,888 (GRCm39) missense probably damaging 1.00
R7009:Cenpe UTSW 3 134,940,963 (GRCm39) missense probably benign 0.02
R7009:Cenpe UTSW 3 134,940,962 (GRCm39) missense probably damaging 0.97
R7039:Cenpe UTSW 3 134,961,217 (GRCm39) missense probably benign 0.28
R7387:Cenpe UTSW 3 134,952,798 (GRCm39) missense probably benign 0.05
R7470:Cenpe UTSW 3 134,947,916 (GRCm39) missense probably damaging 1.00
R7535:Cenpe UTSW 3 134,949,523 (GRCm39) missense possibly damaging 0.90
R7562:Cenpe UTSW 3 134,954,395 (GRCm39) missense probably damaging 1.00
R7573:Cenpe UTSW 3 134,953,220 (GRCm39) missense probably damaging 1.00
R7613:Cenpe UTSW 3 134,948,063 (GRCm39) missense possibly damaging 0.90
R7741:Cenpe UTSW 3 134,953,096 (GRCm39) splice site probably null
R7771:Cenpe UTSW 3 134,946,702 (GRCm39) splice site probably null
R7843:Cenpe UTSW 3 134,938,720 (GRCm39) nonsense probably null
R7973:Cenpe UTSW 3 134,929,011 (GRCm39) missense probably damaging 1.00
R8036:Cenpe UTSW 3 134,945,609 (GRCm39) frame shift probably null
R8069:Cenpe UTSW 3 134,949,479 (GRCm39) missense probably damaging 1.00
R8151:Cenpe UTSW 3 134,952,783 (GRCm39) missense probably benign 0.28
R8176:Cenpe UTSW 3 134,935,851 (GRCm39) missense probably damaging 1.00
R8191:Cenpe UTSW 3 134,957,375 (GRCm39) missense probably benign
R8251:Cenpe UTSW 3 134,957,445 (GRCm39) critical splice donor site probably null
R8425:Cenpe UTSW 3 134,948,388 (GRCm39) nonsense probably null
R8488:Cenpe UTSW 3 134,965,002 (GRCm39) missense probably damaging 1.00
R8811:Cenpe UTSW 3 134,929,001 (GRCm39) missense probably damaging 1.00
R8850:Cenpe UTSW 3 134,930,777 (GRCm39) missense probably damaging 1.00
R8879:Cenpe UTSW 3 134,965,862 (GRCm39) missense probably damaging 0.99
R8899:Cenpe UTSW 3 134,945,644 (GRCm39) missense probably benign 0.18
R9038:Cenpe UTSW 3 134,923,797 (GRCm39) missense probably benign 0.00
R9093:Cenpe UTSW 3 134,945,641 (GRCm39) nonsense probably null
R9221:Cenpe UTSW 3 134,935,839 (GRCm39) missense possibly damaging 0.90
R9365:Cenpe UTSW 3 134,954,207 (GRCm39) missense possibly damaging 0.56
R9443:Cenpe UTSW 3 134,976,609 (GRCm39) missense probably damaging 0.99
Z1177:Cenpe UTSW 3 134,922,146 (GRCm39) missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TATTTCAGCAGGCTAGGGTTC -3'
(R):5'- TATTCCCAGTGACACCCAGC -3'

Sequencing Primer
(F):5'- GCCCACATTGAAGAATTGAGTTGTC -3'
(R):5'- AGCAACCTGAGCGGCTAC -3'
Posted On 2021-11-19