Mutagenetix > Incidental Mutation

Incidental Mutation 'R9035:Cenpe'

687283

Institutional Source

Beutler Lab

Gene Symbol

Cenpe

Ensembl Gene

ENSMUSG00000045328

Gene Name

centromere protein E

Synonyms

312kDa, CENP-E, Kif10, N-7 kinesin

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9035 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

135212537-135273611 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 135270811 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 2393 (N2393S)

Ref Sequence

ENSEMBL: ENSMUSP00000057938 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062893]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000062893
AA Change: N2393S

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000057938
Gene: ENSMUSG00000045328
AA Change: N2393S

Domain	Start	End	E-Value	Type
KISc	4	337	2.4e-172	SMART
coiled coil region	493	612	N/A	INTRINSIC
coiled coil region	637	752	N/A	INTRINSIC
internal_repeat_1	768	801	3.5e-5	PROSPERO
coiled coil region	821	991	N/A	INTRINSIC
low complexity region	1119	1143	N/A	INTRINSIC
internal_repeat_2	1225	1238	6.26e-5	PROSPERO
low complexity region	1446	1467	N/A	INTRINSIC
low complexity region	1480	1498	N/A	INTRINSIC
internal_repeat_2	1614	1627	6.26e-5	PROSPERO
internal_repeat_1	2018	2051	3.5e-5	PROSPERO
coiled coil region	2226	2247	N/A	INTRINSIC
coiled coil region	2316	2363	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.3%

Validation Efficiency

99% (90/91)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Centrosome-associated protein E (CENPE) is a kinesin-like motor protein that accumulates in the G2 phase of the cell cycle. Unlike other centrosome-associated proteins, it is not present during interphase and first appears at the centromere region of chromosomes during prometaphase. This protein is required for stable spindle microtubule capture at kinetochores which is a necessary step in chromosome alignment during prometaphase. This protein also couples chromosome position to microtubule depolymerizing activity. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for a knock-out allele display early embryonic lethality. Mutant embryos grown in culture exhibit inner cell mass growth defects and mitotic chromosome misalignment. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6430573F11Rik	C	T	8: 36,511,800	R186*	probably null	Het
Abca9	A	G	11: 110,130,635	L1083P	probably damaging	Het
Anxa7	G	T	14: 20,460,392	T356K	probably damaging	Het
Atg16l1	T	C	1: 87,765,445		probably null	Het
Bptf	A	G	11: 107,073,016	V1784A	probably damaging	Het
Cabs1	T	C	5: 87,980,450	V320A	probably damaging	Het
Camta1	A	C	4: 151,144,702	S558A	probably benign	Het
Ccdc180	A	T	4: 45,906,922	K466*	probably null	Het
Cdhr1	G	A	14: 37,088,967	P279L	possibly damaging	Het
Cep104	T	C	4: 153,979,005	V8A	probably benign	Het
Chaf1a	T	A	17: 56,064,110	V665E	probably damaging	Het
Clasp1	T	A	1: 118,503,853	D404E	probably damaging	Het
Clnk	G	A	5: 38,750,408	T169I	possibly damaging	Het
Cnst	G	A	1: 179,610,022	A384T	possibly damaging	Het
Ctnnd2	T	A	15: 30,332,016	M15K	possibly damaging	Het
Dlgap1	T	A	17: 70,516,860	L280Q	possibly damaging	Het
Dll1	T	C	17: 15,368,697	K572R	probably benign	Het
Dolk	C	A	2: 30,284,530	W501L	probably damaging	Het
Ednrb	G	A	14: 103,843,229	P83L	probably benign	Het
Edrf1	T	C	7: 133,643,702	W190R	probably damaging	Het
Epha5	T	A	5: 84,108,027	D468V	probably damaging	Het
Fat2	G	T	11: 55,303,721	P1164Q	probably damaging	Het
Fbln5	A	T	12: 101,750,782	V436E	probably damaging	Het
Fbxw10	G	T	11: 62,867,623	R558L	possibly damaging	Het
Fhod3	C	A	18: 25,028,083	S557R	probably benign	Het
Gm340	A	T	19: 41,584,960	H718L	probably benign	Het
Gmip	A	T	8: 69,820,648	H863L	probably damaging	Het
Grm3	A	T	5: 9,570,464	I260N	probably damaging	Het
Gtpbp8	G	A	16: 44,746,148	P64S	probably benign	Het
Hand1	A	C	11: 57,831,722	M22R	probably benign	Het
Igsf21	A	G	4: 140,157,471	V58A	probably damaging	Het
Ikzf2	G	A	1: 69,539,478	R291*	probably null	Het
Itih4	C	G	14: 30,896,693	P687R	probably benign	Het
Kifc3	C	T	8: 95,126,567	D54N	possibly damaging	Het
Kmt2c	G	T	5: 25,319,012	Q1739K	probably damaging	Het
Krtap4-1	G	T	11: 99,627,882	R101S	unknown	Het
L3mbtl2	T	A	15: 81,676,543		probably benign	Het
Lrrc73	T	C	17: 46,254,367	I8T	probably damaging	Het
Med19	C	A	2: 84,686,188		probably benign	Het
Mgarp	C	T	3: 51,388,843	S246N	unknown	Het
Mkrn2	T	C	6: 115,617,720	S414P	possibly damaging	Het
Mucl2	C	T	15: 103,896,013	R137H	unknown	Het
Myo1g	A	G	11: 6,514,916	Y453H	probably damaging	Het
Nacc2	C	A	2: 26,061,593	R410L	probably damaging	Het
Ndufs3	C	T	2: 90,894,873	R210H	probably damaging	Het
Nlgn1	G	T	3: 25,434,431	T580K	probably damaging	Het
Nobox	A	T	6: 43,307,588	D41E	probably damaging	Het
Nsd1	A	G	13: 55,245,854	R526G	possibly damaging	Het
Nt5e	A	G	9: 88,364,820	M370V	probably benign	Het
Olfm5	T	A	7: 104,153,892	N455Y	probably damaging	Het
Olfr1080	T	A	2: 86,553,677	Y149F	probably damaging	Het
Olfr1188	T	A	2: 88,559,519	F6I	probably damaging	Het
Olfr130	T	C	17: 38,067,288	V39A	probably benign	Het
Olfr150	G	A	9: 39,737,590	M258I	probably benign	Het
Olfr596	T	C	7: 103,309,979	I86T	probably damaging	Het
Pcdhac2	T	C	18: 37,144,705	V246A	probably damaging	Het
Pclo	A	T	5: 14,713,178	Q603H		Het
Pkd1l3	GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA	GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA	8: 109,624,195		probably benign	Het
Pkhd1	T	A	1: 20,502,952	Q1910L	probably damaging	Het
Plg	C	A	17: 12,390,220	Y137*	probably null	Het
Prkra	T	C	2: 76,630,512	I281V	probably benign	Het
Prrc2c	A	C	1: 162,675,726	L2722R	possibly damaging	Het
Prss12	A	G	3: 123,485,500	T409A	probably damaging	Het
Rnaseh1	A	G	12: 28,658,291	Q256R	probably benign	Het
Rpp14	T	A	14: 8,083,772	Y17N	possibly damaging	Het
Ryr1	A	T	7: 29,090,997	H1468Q	probably damaging	Het
Scp2	C	T	4: 108,055,520	V463M	probably damaging	Het
Sf3b4	C	A	3: 96,173,065	H43Q	probably damaging	Het
Sgpp1	T	C	12: 75,735,464	S34G	probably benign	Het
Shisa9	T	A	16: 11,985,038	I153N	probably damaging	Het
Sin3b	C	A	8: 72,723,464	P3H	unknown	Het
Slc15a2	C	A	16: 36,782,357	K47N	possibly damaging	Het
Slc30a6	T	A	17: 74,419,591	F297L	probably benign	Het
Slc45a3	TGGGG	TGGGGG	1: 131,981,449		probably null	Het
Slfn4	A	T	11: 83,186,650	D88V	probably benign	Het
Tgs1	C	A	4: 3,593,491	Q460K	probably benign	Het
Tlr11	A	T	14: 50,360,977	D140V	probably benign	Het
Tmem215	T	A	4: 40,473,945	N7K	probably damaging	Het
Tmem245	T	C	4: 56,922,384		probably benign	Het
Tnfsf10	G	A	3: 27,335,230	D147N	probably benign	Het
Tpm1	A	G	9: 67,047,856	L57P	possibly damaging	Het
Trappc10	T	C	10: 78,207,889		probably benign	Het
Ttc30b	T	C	2: 75,937,252	T386A	probably benign	Het
Ttn	T	C	2: 76,762,717	T20730A	possibly damaging	Het
Uap1	A	T	1: 170,149,444	Y395*	probably null	Het
Usp2	A	T	9: 44,075,879	D158V	probably damaging	Het
Usp30	A	G	5: 114,105,816	M149V	probably benign	Het
Vmn2r2	T	C	3: 64,116,751	N803S	probably damaging	Het
Vmn2r85	A	G	10: 130,425,610	V286A	probably benign	Het
Wdr78	T	A	4: 103,048,302	K761*	probably null	Het
Xdh	T	C	17: 73,910,227	H682R	probably benign	Het
Zbed3	T	A	13: 95,336,491	L141Q	probably damaging	Het
Zfp623	T	C	15: 75,948,313	C373R	possibly damaging	Het

Other mutations in Cenpe

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00655:Cenpe	APN	3	135231455	critical splice donor site	probably null
IGL00799:Cenpe	APN	3	135228917	critical splice donor site	probably null
IGL00815:Cenpe	APN	3	135259351	missense	probably benign
IGL01446:Cenpe	APN	3	135237539	missense	probably benign	0.01
IGL01469:Cenpe	APN	3	135228806	missense	probably damaging	1.00
IGL01843:Cenpe	APN	3	135218507	missense	possibly damaging	0.88
IGL02254:Cenpe	APN	3	135255477	missense	probably benign
IGL02337:Cenpe	APN	3	135220276	splice site	probably benign
IGL02382:Cenpe	APN	3	135247386	missense	probably benign
IGL02458:Cenpe	APN	3	135230108	nonsense	probably null
IGL02934:Cenpe	APN	3	135264351	missense	probably damaging	1.00
IGL03335:Cenpe	APN	3	135243625	missense	probably benign
R0086:Cenpe	UTSW	3	135264424	splice site	probably benign
R0173:Cenpe	UTSW	3	135259983	missense	probably benign	0.00
R0394:Cenpe	UTSW	3	135216425	splice site	probably benign
R0411:Cenpe	UTSW	3	135222255	missense	probably damaging	1.00
R0624:Cenpe	UTSW	3	135246586	missense	probably benign	0.00
R0634:Cenpe	UTSW	3	135246827	missense	probably damaging	1.00
R0648:Cenpe	UTSW	3	135230082	missense	probably damaging	1.00
R0691:Cenpe	UTSW	3	135217305	missense	probably damaging	1.00
R1184:Cenpe	UTSW	3	135264422	critical splice donor site	probably null
R1530:Cenpe	UTSW	3	135246902	missense	possibly damaging	0.92
R1559:Cenpe	UTSW	3	135270900	missense	probably benign	0.07
R1562:Cenpe	UTSW	3	135238394	missense	possibly damaging	0.53
R1568:Cenpe	UTSW	3	135239758	missense	probably benign	0.01
R1712:Cenpe	UTSW	3	135265933	missense	probably damaging	0.99
R1828:Cenpe	UTSW	3	135246496	missense	probably damaging	0.99
R1846:Cenpe	UTSW	3	135239845	missense	probably damaging	1.00
R1861:Cenpe	UTSW	3	135268979	missense	probably damaging	1.00
R1938:Cenpe	UTSW	3	135247479	missense	probably damaging	0.98
R1961:Cenpe	UTSW	3	135242493	missense	probably damaging	1.00
R2062:Cenpe	UTSW	3	135222321	splice site	probably benign
R2118:Cenpe	UTSW	3	135246884	missense	possibly damaging	0.94
R2127:Cenpe	UTSW	3	135239780	missense	probably benign	0.08
R2156:Cenpe	UTSW	3	135247474	missense	probably benign	0.34
R2265:Cenpe	UTSW	3	135261636	missense	probably benign	0.02
R2268:Cenpe	UTSW	3	135261636	missense	probably benign	0.02
R2392:Cenpe	UTSW	3	135248113	missense	probably damaging	1.00
R2508:Cenpe	UTSW	3	135241073	missense	possibly damaging	0.92
R3084:Cenpe	UTSW	3	135241021	missense	probably damaging	1.00
R3779:Cenpe	UTSW	3	135256576	missense	possibly damaging	0.87
R3833:Cenpe	UTSW	3	135222322	splice site	probably benign
R3974:Cenpe	UTSW	3	135235225	splice site	probably null
R3975:Cenpe	UTSW	3	135235225	splice site	probably null
R3975:Cenpe	UTSW	3	135238472	critical splice donor site	probably null
R4151:Cenpe	UTSW	3	135215153	missense	probably benign	0.36
R4166:Cenpe	UTSW	3	135243718	missense	probably damaging	1.00
R4581:Cenpe	UTSW	3	135247000	missense	probably benign	0.30
R4622:Cenpe	UTSW	3	135243708	missense	probably benign	0.22
R4692:Cenpe	UTSW	3	135216379	missense	probably benign	0.29
R4769:Cenpe	UTSW	3	135248151	missense	probably benign
R4976:Cenpe	UTSW	3	135234876	missense	probably damaging	1.00
R4983:Cenpe	UTSW	3	135234928	missense	probably damaging	1.00
R4990:Cenpe	UTSW	3	135256640	missense	probably damaging	1.00
R5002:Cenpe	UTSW	3	135247081	missense	probably benign
R5057:Cenpe	UTSW	3	135220313	missense	probably benign	0.14
R5063:Cenpe	UTSW	3	135270954	missense	probably damaging	0.99
R5181:Cenpe	UTSW	3	135242303	missense	probably damaging	0.99
R5281:Cenpe	UTSW	3	135230150	missense	possibly damaging	0.89
R5389:Cenpe	UTSW	3	135259388	critical splice donor site	probably null
R5517:Cenpe	UTSW	3	135223265	missense	probably damaging	1.00
R5521:Cenpe	UTSW	3	135269065	missense	probably damaging	1.00
R5607:Cenpe	UTSW	3	135235076	nonsense	probably null
R5608:Cenpe	UTSW	3	135235076	nonsense	probably null
R5627:Cenpe	UTSW	3	135235473	missense	possibly damaging	0.51
R5766:Cenpe	UTSW	3	135248413	missense	probably damaging	0.96
R5783:Cenpe	UTSW	3	135261580	missense	probably benign	0.00
R5933:Cenpe	UTSW	3	135261628	missense	probably benign	0.03
R6073:Cenpe	UTSW	3	135260073	nonsense	probably null
R6163:Cenpe	UTSW	3	135269003	missense	probably damaging	0.99
R6192:Cenpe	UTSW	3	135248530	missense	possibly damaging	0.93
R6224:Cenpe	UTSW	3	135243775	missense	possibly damaging	0.87
R6313:Cenpe	UTSW	3	135230175	missense	probably benign	0.26
R6326:Cenpe	UTSW	3	135239778	missense	probably benign	0.15
R6383:Cenpe	UTSW	3	135251528	missense	probably damaging	1.00
R6418:Cenpe	UTSW	3	135251544	missense	probably damaging	0.99
R6797:Cenpe	UTSW	3	135238138	missense	possibly damaging	0.92
R6810:Cenpe	UTSW	3	135243822	missense	probably benign	0.00
R6989:Cenpe	UTSW	3	135235127	missense	probably damaging	1.00
R7009:Cenpe	UTSW	3	135235201	missense	probably damaging	0.97
R7009:Cenpe	UTSW	3	135235202	missense	probably benign	0.02
R7039:Cenpe	UTSW	3	135255456	missense	probably benign	0.28
R7387:Cenpe	UTSW	3	135247037	missense	probably benign	0.05
R7470:Cenpe	UTSW	3	135242155	missense	probably damaging	1.00
R7535:Cenpe	UTSW	3	135243762	missense	possibly damaging	0.90
R7562:Cenpe	UTSW	3	135248634	missense	probably damaging	1.00
R7573:Cenpe	UTSW	3	135247459	missense	probably damaging	1.00
R7613:Cenpe	UTSW	3	135242302	missense	possibly damaging	0.90
R7741:Cenpe	UTSW	3	135247335	splice site	probably null
R7771:Cenpe	UTSW	3	135240941	splice site	probably null
R7843:Cenpe	UTSW	3	135232959	nonsense	probably null
R7973:Cenpe	UTSW	3	135223250	missense	probably damaging	1.00
R8036:Cenpe	UTSW	3	135239848	frame shift	probably null
R8069:Cenpe	UTSW	3	135243718	missense	probably damaging	1.00
R8151:Cenpe	UTSW	3	135247022	missense	probably benign	0.28
R8176:Cenpe	UTSW	3	135230090	missense	probably damaging	1.00
R8191:Cenpe	UTSW	3	135251614	missense	probably benign
R8251:Cenpe	UTSW	3	135251684	critical splice donor site	probably null
R8425:Cenpe	UTSW	3	135242627	nonsense	probably null
R8488:Cenpe	UTSW	3	135259241	missense	probably damaging	1.00
R8811:Cenpe	UTSW	3	135223240	missense	probably damaging	1.00
R8850:Cenpe	UTSW	3	135225016	missense	probably damaging	1.00
R8879:Cenpe	UTSW	3	135260101	missense	probably damaging	0.99
R8899:Cenpe	UTSW	3	135239883	missense	probably benign	0.18
R9038:Cenpe	UTSW	3	135218036	missense	probably benign	0.00
R9093:Cenpe	UTSW	3	135239880	nonsense	probably null
R9221:Cenpe	UTSW	3	135230078	missense	possibly damaging	0.90
R9365:Cenpe	UTSW	3	135248446	missense	possibly damaging	0.56
R9443:Cenpe	UTSW	3	135270848	missense	probably damaging	0.99
Z1177:Cenpe	UTSW	3	135216385	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- TATTTCAGCAGGCTAGGGTTC -3'
(R):5'- TATTCCCAGTGACACCCAGC -3'

Sequencing Primer
(F):5'- GCCCACATTGAAGAATTGAGTTGTC -3'
(R):5'- AGCAACCTGAGCGGCTAC -3'

Posted On

2021-11-19