Incidental Mutation 'R9035:Nt5e'
ID 687313
Institutional Source Beutler Lab
Gene Symbol Nt5e
Ensembl Gene ENSMUSG00000032420
Gene Name 5' nucleotidase, ecto
Synonyms ecto-5'-nucleotidase, CD73, Nt5, 2210401F01Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9035 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 88327197-88372092 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 88364820 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 370 (M370V)
Ref Sequence ENSEMBL: ENSMUSP00000034992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034992]
AlphaFold Q61503
Predicted Effect probably benign
Transcript: ENSMUST00000034992
AA Change: M370V

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000034992
Gene: ENSMUSG00000032420
AA Change: M370V

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Metallophos 31 248 2.1e-15 PFAM
Pfam:5_nucleotid_C 340 515 4.9e-45 PFAM
transmembrane domain 553 575 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a membrane-bound nucleotidase that hydrolyzes extracellular nucleoside monophosphates. The encoded preproprotein undergoes proteolytic processing to generate to a functional, homodimeric enzyme that preferentially uses adenosine monophosphate as a substrate to generate free adenosine. Mice lacking the encoded protein exhibit a significantly reduced fall in stop flow pressure and superficial nephron glomerular filtration rate in response to a saturating increase of tubular perfusion flow. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygous null mice for one allele are viable and fertile with increased circulating alkaline phosphatase and impaired tubuloglomerular feedback regulation. Homozygous null mice for a second allele display increased vascular permeability especially under hypoxic conditions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik C T 8: 36,511,800 R186* probably null Het
Abca9 A G 11: 110,130,635 L1083P probably damaging Het
Anxa7 G T 14: 20,460,392 T356K probably damaging Het
Atg16l1 T C 1: 87,765,445 probably null Het
Bptf A G 11: 107,073,016 V1784A probably damaging Het
Cabs1 T C 5: 87,980,450 V320A probably damaging Het
Camta1 A C 4: 151,144,702 S558A probably benign Het
Ccdc180 A T 4: 45,906,922 K466* probably null Het
Cdhr1 G A 14: 37,088,967 P279L possibly damaging Het
Cenpe A G 3: 135,270,811 N2393S probably benign Het
Cep104 T C 4: 153,979,005 V8A probably benign Het
Chaf1a T A 17: 56,064,110 V665E probably damaging Het
Clasp1 T A 1: 118,503,853 D404E probably damaging Het
Clnk G A 5: 38,750,408 T169I possibly damaging Het
Cnst G A 1: 179,610,022 A384T possibly damaging Het
Ctnnd2 T A 15: 30,332,016 M15K possibly damaging Het
Dlgap1 T A 17: 70,516,860 L280Q possibly damaging Het
Dll1 T C 17: 15,368,697 K572R probably benign Het
Dolk C A 2: 30,284,530 W501L probably damaging Het
Ednrb G A 14: 103,843,229 P83L probably benign Het
Edrf1 T C 7: 133,643,702 W190R probably damaging Het
Epha5 T A 5: 84,108,027 D468V probably damaging Het
Fat2 G T 11: 55,303,721 P1164Q probably damaging Het
Fbln5 A T 12: 101,750,782 V436E probably damaging Het
Fbxw10 G T 11: 62,867,623 R558L possibly damaging Het
Fhod3 C A 18: 25,028,083 S557R probably benign Het
Gm340 A T 19: 41,584,960 H718L probably benign Het
Gmip A T 8: 69,820,648 H863L probably damaging Het
Grm3 A T 5: 9,570,464 I260N probably damaging Het
Gtpbp8 G A 16: 44,746,148 P64S probably benign Het
Hand1 A C 11: 57,831,722 M22R probably benign Het
Igsf21 A G 4: 140,157,471 V58A probably damaging Het
Ikzf2 G A 1: 69,539,478 R291* probably null Het
Itih4 C G 14: 30,896,693 P687R probably benign Het
Kifc3 C T 8: 95,126,567 D54N possibly damaging Het
Kmt2c G T 5: 25,319,012 Q1739K probably damaging Het
Krtap4-1 G T 11: 99,627,882 R101S unknown Het
Lrrc73 T C 17: 46,254,367 I8T probably damaging Het
Mgarp C T 3: 51,388,843 S246N unknown Het
Mkrn2 T C 6: 115,617,720 S414P possibly damaging Het
Mucl2 C T 15: 103,896,013 R137H unknown Het
Myo1g A G 11: 6,514,916 Y453H probably damaging Het
Nacc2 C A 2: 26,061,593 R410L probably damaging Het
Ndufs3 C T 2: 90,894,873 R210H probably damaging Het
Nlgn1 G T 3: 25,434,431 T580K probably damaging Het
Nobox A T 6: 43,307,588 D41E probably damaging Het
Nsd1 A G 13: 55,245,854 R526G possibly damaging Het
Olfm5 T A 7: 104,153,892 N455Y probably damaging Het
Olfr1080 T A 2: 86,553,677 Y149F probably damaging Het
Olfr1188 T A 2: 88,559,519 F6I probably damaging Het
Olfr130 T C 17: 38,067,288 V39A probably benign Het
Olfr150 G A 9: 39,737,590 M258I probably benign Het
Olfr596 T C 7: 103,309,979 I86T probably damaging Het
Pcdhac2 T C 18: 37,144,705 V246A probably damaging Het
Pclo A T 5: 14,713,178 Q603H Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Pkhd1 T A 1: 20,502,952 Q1910L probably damaging Het
Plg C A 17: 12,390,220 Y137* probably null Het
Prkra T C 2: 76,630,512 I281V probably benign Het
Prrc2c A C 1: 162,675,726 L2722R possibly damaging Het
Prss12 A G 3: 123,485,500 T409A probably damaging Het
Rnaseh1 A G 12: 28,658,291 Q256R probably benign Het
Rpp14 T A 14: 8,083,772 Y17N possibly damaging Het
Ryr1 A T 7: 29,090,997 H1468Q probably damaging Het
Scp2 C T 4: 108,055,520 V463M probably damaging Het
Sf3b4 C A 3: 96,173,065 H43Q probably damaging Het
Sgpp1 T C 12: 75,735,464 S34G probably benign Het
Shisa9 T A 16: 11,985,038 I153N probably damaging Het
Sin3b C A 8: 72,723,464 P3H unknown Het
Slc15a2 C A 16: 36,782,357 K47N possibly damaging Het
Slc30a6 T A 17: 74,419,591 F297L probably benign Het
Slc45a3 TGGGG TGGGGG 1: 131,981,449 probably null Het
Slfn4 A T 11: 83,186,650 D88V probably benign Het
Tgs1 C A 4: 3,593,491 Q460K probably benign Het
Tlr11 A T 14: 50,360,977 D140V probably benign Het
Tmem215 T A 4: 40,473,945 N7K probably damaging Het
Tnfsf10 G A 3: 27,335,230 D147N probably benign Het
Tpm1 A G 9: 67,047,856 L57P possibly damaging Het
Ttc30b T C 2: 75,937,252 T386A probably benign Het
Ttn T C 2: 76,762,717 T20730A possibly damaging Het
Uap1 A T 1: 170,149,444 Y395* probably null Het
Usp2 A T 9: 44,075,879 D158V probably damaging Het
Usp30 A G 5: 114,105,816 M149V probably benign Het
Vmn2r2 T C 3: 64,116,751 N803S probably damaging Het
Vmn2r85 A G 10: 130,425,610 V286A probably benign Het
Wdr78 T A 4: 103,048,302 K761* probably null Het
Xdh T C 17: 73,910,227 H682R probably benign Het
Zbed3 T A 13: 95,336,491 L141Q probably damaging Het
Zfp623 T C 15: 75,948,313 C373R possibly damaging Het
Other mutations in Nt5e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01794:Nt5e APN 9 88367298 missense probably damaging 0.97
IGL02015:Nt5e APN 9 88367237 missense probably damaging 1.00
IGL02351:Nt5e APN 9 88327893 missense probably damaging 1.00
IGL02358:Nt5e APN 9 88327893 missense probably damaging 1.00
IGL02826:Nt5e APN 9 88355705 missense probably damaging 0.97
IGL03237:Nt5e APN 9 88355734 missense probably damaging 1.00
R0092:Nt5e UTSW 9 88370285 missense probably benign 0.00
R0238:Nt5e UTSW 9 88367332 missense possibly damaging 0.81
R0238:Nt5e UTSW 9 88367332 missense possibly damaging 0.81
R0557:Nt5e UTSW 9 88366466 missense probably damaging 1.00
R1727:Nt5e UTSW 9 88328029 missense possibly damaging 0.87
R1834:Nt5e UTSW 9 88370187 missense probably damaging 1.00
R2361:Nt5e UTSW 9 88370237 missense possibly damaging 0.67
R3871:Nt5e UTSW 9 88364693 missense probably benign 0.04
R4990:Nt5e UTSW 9 88355593 missense probably benign 0.03
R5039:Nt5e UTSW 9 88363581 missense probably benign 0.00
R5642:Nt5e UTSW 9 88327687 start codon destroyed probably null 0.02
R5812:Nt5e UTSW 9 88369055 missense probably damaging 1.00
R6389:Nt5e UTSW 9 88363471 missense probably damaging 1.00
R7003:Nt5e UTSW 9 88364752 missense probably damaging 1.00
R8325:Nt5e UTSW 9 88363562 missense probably benign 0.16
R9191:Nt5e UTSW 9 88364821 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GCCTGGCAAAACTCCATTTCTC -3'
(R):5'- ACTCTGCTAAGTGTTTTGGGCC -3'

Sequencing Primer
(F):5'- ACTAGGAGATCTGCCCGGATTAC -3'
(R):5'- CTAAGTGTTTTGGGCCTCCTTGC -3'
Posted On 2021-11-19