Incidental Mutation 'R9035:Olfr130'
ID 687342
Institutional Source Beutler Lab
Gene Symbol Olfr130
Ensembl Gene ENSMUSG00000094878
Gene Name olfactory receptor 130
Synonyms GA_x6K02T2PSCP-2515350-2516303, MOR256-19
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock # R9035 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 38063921-38072790 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 38067288 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 39 (V39A)
Ref Sequence ENSEMBL: ENSMUSP00000149963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087129] [ENSMUST00000215726] [ENSMUST00000217390]
AlphaFold Q8VFC1
Predicted Effect probably benign
Transcript: ENSMUST00000087129
AA Change: V39A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000084369
Gene: ENSMUSG00000094878
AA Change: V39A

DomainStartEndE-ValueType
Pfam:7tm_4 29 307 1.8e-44 PFAM
Pfam:7TM_GPCR_Srsx 34 223 1.9e-5 PFAM
Pfam:7tm_1 40 289 1.9e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215726
AA Change: V39A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000217390
AA Change: V39A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik C T 8: 36,511,800 R186* probably null Het
Abca9 A G 11: 110,130,635 L1083P probably damaging Het
Anxa7 G T 14: 20,460,392 T356K probably damaging Het
Atg16l1 T C 1: 87,765,445 probably null Het
Bptf A G 11: 107,073,016 V1784A probably damaging Het
Cabs1 T C 5: 87,980,450 V320A probably damaging Het
Camta1 A C 4: 151,144,702 S558A probably benign Het
Ccdc180 A T 4: 45,906,922 K466* probably null Het
Cdhr1 G A 14: 37,088,967 P279L possibly damaging Het
Cenpe A G 3: 135,270,811 N2393S probably benign Het
Cep104 T C 4: 153,979,005 V8A probably benign Het
Chaf1a T A 17: 56,064,110 V665E probably damaging Het
Clasp1 T A 1: 118,503,853 D404E probably damaging Het
Clnk G A 5: 38,750,408 T169I possibly damaging Het
Cnst G A 1: 179,610,022 A384T possibly damaging Het
Ctnnd2 T A 15: 30,332,016 M15K possibly damaging Het
Dlgap1 T A 17: 70,516,860 L280Q possibly damaging Het
Dll1 T C 17: 15,368,697 K572R probably benign Het
Dolk C A 2: 30,284,530 W501L probably damaging Het
Ednrb G A 14: 103,843,229 P83L probably benign Het
Edrf1 T C 7: 133,643,702 W190R probably damaging Het
Epha5 T A 5: 84,108,027 D468V probably damaging Het
Fat2 G T 11: 55,303,721 P1164Q probably damaging Het
Fbln5 A T 12: 101,750,782 V436E probably damaging Het
Fbxw10 G T 11: 62,867,623 R558L possibly damaging Het
Fhod3 C A 18: 25,028,083 S557R probably benign Het
Gm340 A T 19: 41,584,960 H718L probably benign Het
Gmip A T 8: 69,820,648 H863L probably damaging Het
Grm3 A T 5: 9,570,464 I260N probably damaging Het
Gtpbp8 G A 16: 44,746,148 P64S probably benign Het
Hand1 A C 11: 57,831,722 M22R probably benign Het
Igsf21 A G 4: 140,157,471 V58A probably damaging Het
Ikzf2 G A 1: 69,539,478 R291* probably null Het
Itih4 C G 14: 30,896,693 P687R probably benign Het
Kifc3 C T 8: 95,126,567 D54N possibly damaging Het
Kmt2c G T 5: 25,319,012 Q1739K probably damaging Het
Krtap4-1 G T 11: 99,627,882 R101S unknown Het
Lrrc73 T C 17: 46,254,367 I8T probably damaging Het
Mgarp C T 3: 51,388,843 S246N unknown Het
Mkrn2 T C 6: 115,617,720 S414P possibly damaging Het
Mucl2 C T 15: 103,896,013 R137H unknown Het
Myo1g A G 11: 6,514,916 Y453H probably damaging Het
Nacc2 C A 2: 26,061,593 R410L probably damaging Het
Ndufs3 C T 2: 90,894,873 R210H probably damaging Het
Nlgn1 G T 3: 25,434,431 T580K probably damaging Het
Nobox A T 6: 43,307,588 D41E probably damaging Het
Nsd1 A G 13: 55,245,854 R526G possibly damaging Het
Nt5e A G 9: 88,364,820 M370V probably benign Het
Olfm5 T A 7: 104,153,892 N455Y probably damaging Het
Olfr1080 T A 2: 86,553,677 Y149F probably damaging Het
Olfr1188 T A 2: 88,559,519 F6I probably damaging Het
Olfr150 G A 9: 39,737,590 M258I probably benign Het
Olfr596 T C 7: 103,309,979 I86T probably damaging Het
Pcdhac2 T C 18: 37,144,705 V246A probably damaging Het
Pclo A T 5: 14,713,178 Q603H Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Pkhd1 T A 1: 20,502,952 Q1910L probably damaging Het
Plg C A 17: 12,390,220 Y137* probably null Het
Prkra T C 2: 76,630,512 I281V probably benign Het
Prrc2c A C 1: 162,675,726 L2722R possibly damaging Het
Prss12 A G 3: 123,485,500 T409A probably damaging Het
Rnaseh1 A G 12: 28,658,291 Q256R probably benign Het
Rpp14 T A 14: 8,083,772 Y17N possibly damaging Het
Ryr1 A T 7: 29,090,997 H1468Q probably damaging Het
Scp2 C T 4: 108,055,520 V463M probably damaging Het
Sf3b4 C A 3: 96,173,065 H43Q probably damaging Het
Sgpp1 T C 12: 75,735,464 S34G probably benign Het
Shisa9 T A 16: 11,985,038 I153N probably damaging Het
Sin3b C A 8: 72,723,464 P3H unknown Het
Slc15a2 C A 16: 36,782,357 K47N possibly damaging Het
Slc30a6 T A 17: 74,419,591 F297L probably benign Het
Slc45a3 TGGGG TGGGGG 1: 131,981,449 probably null Het
Slfn4 A T 11: 83,186,650 D88V probably benign Het
Tgs1 C A 4: 3,593,491 Q460K probably benign Het
Tlr11 A T 14: 50,360,977 D140V probably benign Het
Tmem215 T A 4: 40,473,945 N7K probably damaging Het
Tnfsf10 G A 3: 27,335,230 D147N probably benign Het
Tpm1 A G 9: 67,047,856 L57P possibly damaging Het
Ttc30b T C 2: 75,937,252 T386A probably benign Het
Ttn T C 2: 76,762,717 T20730A possibly damaging Het
Uap1 A T 1: 170,149,444 Y395* probably null Het
Usp2 A T 9: 44,075,879 D158V probably damaging Het
Usp30 A G 5: 114,105,816 M149V probably benign Het
Vmn2r2 T C 3: 64,116,751 N803S probably damaging Het
Vmn2r85 A G 10: 130,425,610 V286A probably benign Het
Wdr78 T A 4: 103,048,302 K761* probably null Het
Xdh T C 17: 73,910,227 H682R probably benign Het
Zbed3 T A 13: 95,336,491 L141Q probably damaging Het
Zfp623 T C 15: 75,948,313 C373R possibly damaging Het
Other mutations in Olfr130
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01527:Olfr130 APN 17 38068095 missense probably benign
IGL02158:Olfr130 APN 17 38067267 missense probably damaging 0.97
IGL03172:Olfr130 APN 17 38067384 missense probably damaging 0.99
R0389:Olfr130 UTSW 17 38067671 missense possibly damaging 0.58
R0448:Olfr130 UTSW 17 38067672 missense probably benign 0.00
R0616:Olfr130 UTSW 17 38067240 missense probably damaging 1.00
R0961:Olfr130 UTSW 17 38067923 missense probably damaging 1.00
R1789:Olfr130 UTSW 17 38067948 missense probably damaging 1.00
R2108:Olfr130 UTSW 17 38067855 missense possibly damaging 0.82
R4600:Olfr130 UTSW 17 38067962 missense probably damaging 0.99
R4977:Olfr130 UTSW 17 38067747 missense possibly damaging 0.67
R5120:Olfr130 UTSW 17 38067266 missense probably damaging 0.97
R5930:Olfr130 UTSW 17 38067750 missense probably benign 0.11
R6273:Olfr130 UTSW 17 38067795 missense probably damaging 1.00
R6636:Olfr130 UTSW 17 38067224 missense probably damaging 0.98
R6637:Olfr130 UTSW 17 38067224 missense probably damaging 0.98
R7030:Olfr130 UTSW 17 38068057 missense probably benign 0.13
R7045:Olfr130 UTSW 17 38067971 missense probably benign 0.01
R7175:Olfr130 UTSW 17 38067479 missense probably damaging 0.96
R7359:Olfr130 UTSW 17 38067615 nonsense probably null
R7762:Olfr130 UTSW 17 38067675 missense probably damaging 1.00
R7980:Olfr130 UTSW 17 38067521 missense possibly damaging 0.64
R8050:Olfr130 UTSW 17 38067479 missense probably damaging 1.00
X0019:Olfr130 UTSW 17 38067722 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAAGTCTGTCAAGAGGATTTCTGATC -3'
(R):5'- ACATTCAGTGGACCCCAGAG -3'

Sequencing Primer
(F):5'- GATTTCTGATCCCATTACATTCCTTC -3'
(R):5'- TGGACCCCAGAGCCAGAG -3'
Posted On 2021-11-19