Incidental Mutation 'R9035:Xdh'
ID687346
Institutional Source Beutler Lab
Gene Symbol Xdh
Ensembl Gene ENSMUSG00000024066
Gene Namexanthine dehydrogenase
Synonymsxanthine oxidase, XO, Xor, Xox1, Xox-1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.280) question?
Stock #R9035 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location73883908-73950182 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73910227 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 682 (H682R)
Ref Sequence ENSEMBL: ENSMUSP00000024866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024866]
AlphaFold Q00519
Predicted Effect probably benign
Transcript: ENSMUST00000024866
AA Change: H682R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000024866
Gene: ENSMUSG00000024066
AA Change: H682R

DomainStartEndE-ValueType
Pfam:Fer2 11 81 5e-12 PFAM
Pfam:Fer2_2 90 163 4.1e-31 PFAM
low complexity region 169 182 N/A INTRINSIC
Pfam:FAD_binding_5 234 414 4.9e-47 PFAM
CO_deh_flav_C 421 525 1.16e-24 SMART
Ald_Xan_dh_C 590 696 1.23e-46 SMART
Pfam:Ald_Xan_dh_C2 704 1239 1e-200 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the xanthine dehydrogenase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. The encoded protein exists as two distinct enzymatic forms, either as xanthine dehydrogenase, or as xanthine oxidase, and functions in purine degradation. Additional studies also suggest a role in adipogenesis, and a function as a structural protein in milk fat droplets in the lactating mammary gland. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygotes for a null allele are small and die prematurely while heterozygous females show a lactation defect. Most homozygotes for another null allele die within the first month of renal failure associated with uric acid depletion, renal tubular damage, inflammation, fibrosis and oxidative stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik C T 8: 36,511,800 R186* probably null Het
Abca9 A G 11: 110,130,635 L1083P probably damaging Het
Anxa7 G T 14: 20,460,392 T356K probably damaging Het
Atg16l1 T C 1: 87,765,445 probably null Het
Bptf A G 11: 107,073,016 V1784A probably damaging Het
Cabs1 T C 5: 87,980,450 V320A probably damaging Het
Camta1 A C 4: 151,144,702 S558A probably benign Het
Ccdc180 A T 4: 45,906,922 K466* probably null Het
Cdhr1 G A 14: 37,088,967 P279L possibly damaging Het
Cenpe A G 3: 135,270,811 N2393S probably benign Het
Cep104 T C 4: 153,979,005 V8A probably benign Het
Chaf1a T A 17: 56,064,110 V665E probably damaging Het
Clasp1 T A 1: 118,503,853 D404E probably damaging Het
Clnk G A 5: 38,750,408 T169I possibly damaging Het
Cnst G A 1: 179,610,022 A384T possibly damaging Het
Ctnnd2 T A 15: 30,332,016 M15K possibly damaging Het
Dlgap1 T A 17: 70,516,860 L280Q possibly damaging Het
Dll1 T C 17: 15,368,697 K572R probably benign Het
Dolk C A 2: 30,284,530 W501L probably damaging Het
Ednrb G A 14: 103,843,229 P83L probably benign Het
Edrf1 T C 7: 133,643,702 W190R probably damaging Het
Epha5 T A 5: 84,108,027 D468V probably damaging Het
Fat2 G T 11: 55,303,721 P1164Q probably damaging Het
Fbln5 A T 12: 101,750,782 V436E probably damaging Het
Fbxw10 G T 11: 62,867,623 R558L possibly damaging Het
Fhod3 C A 18: 25,028,083 S557R probably benign Het
Gm340 A T 19: 41,584,960 H718L probably benign Het
Gmip A T 8: 69,820,648 H863L probably damaging Het
Grm3 A T 5: 9,570,464 I260N probably damaging Het
Gtpbp8 G A 16: 44,746,148 P64S probably benign Het
Hand1 A C 11: 57,831,722 M22R probably benign Het
Igsf21 A G 4: 140,157,471 V58A probably damaging Het
Ikzf2 G A 1: 69,539,478 R291* probably null Het
Itih4 C G 14: 30,896,693 P687R probably benign Het
Kifc3 C T 8: 95,126,567 D54N possibly damaging Het
Kmt2c G T 5: 25,319,012 Q1739K probably damaging Het
Krtap4-1 G T 11: 99,627,882 R101S unknown Het
Lrrc73 T C 17: 46,254,367 I8T probably damaging Het
Mgarp C T 3: 51,388,843 S246N unknown Het
Mkrn2 T C 6: 115,617,720 S414P possibly damaging Het
Mucl2 C T 15: 103,896,013 R137H unknown Het
Myo1g A G 11: 6,514,916 Y453H probably damaging Het
Nacc2 C A 2: 26,061,593 R410L probably damaging Het
Ndufs3 C T 2: 90,894,873 R210H probably damaging Het
Nlgn1 G T 3: 25,434,431 T580K probably damaging Het
Nobox A T 6: 43,307,588 D41E probably damaging Het
Nsd1 A G 13: 55,245,854 R526G possibly damaging Het
Nt5e A G 9: 88,364,820 M370V probably benign Het
Olfm5 T A 7: 104,153,892 N455Y probably damaging Het
Olfr1080 T A 2: 86,553,677 Y149F probably damaging Het
Olfr1188 T A 2: 88,559,519 F6I probably damaging Het
Olfr130 T C 17: 38,067,288 V39A probably benign Het
Olfr150 G A 9: 39,737,590 M258I probably benign Het
Olfr596 T C 7: 103,309,979 I86T probably damaging Het
Pcdhac2 T C 18: 37,144,705 V246A probably damaging Het
Pclo A T 5: 14,713,178 Q603H Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Pkhd1 T A 1: 20,502,952 Q1910L probably damaging Het
Plg C A 17: 12,390,220 Y137* probably null Het
Prkra T C 2: 76,630,512 I281V probably benign Het
Prrc2c A C 1: 162,675,726 L2722R possibly damaging Het
Prss12 A G 3: 123,485,500 T409A probably damaging Het
Rnaseh1 A G 12: 28,658,291 Q256R probably benign Het
Rpp14 T A 14: 8,083,772 Y17N possibly damaging Het
Ryr1 A T 7: 29,090,997 H1468Q probably damaging Het
Scp2 C T 4: 108,055,520 V463M probably damaging Het
Sf3b4 C A 3: 96,173,065 H43Q probably damaging Het
Sgpp1 T C 12: 75,735,464 S34G probably benign Het
Shisa9 T A 16: 11,985,038 I153N probably damaging Het
Sin3b C A 8: 72,723,464 P3H unknown Het
Slc15a2 C A 16: 36,782,357 K47N possibly damaging Het
Slc30a6 T A 17: 74,419,591 F297L probably benign Het
Slc45a3 TGGGG TGGGGG 1: 131,981,449 probably null Het
Slfn4 A T 11: 83,186,650 D88V probably benign Het
Tgs1 C A 4: 3,593,491 Q460K probably benign Het
Tlr11 A T 14: 50,360,977 D140V probably benign Het
Tmem215 T A 4: 40,473,945 N7K probably damaging Het
Tnfsf10 G A 3: 27,335,230 D147N probably benign Het
Tpm1 A G 9: 67,047,856 L57P possibly damaging Het
Ttc30b T C 2: 75,937,252 T386A probably benign Het
Ttn T C 2: 76,762,717 T20730A possibly damaging Het
Uap1 A T 1: 170,149,444 Y395* probably null Het
Usp2 A T 9: 44,075,879 D158V probably damaging Het
Usp30 A G 5: 114,105,816 M149V probably benign Het
Vmn2r2 T C 3: 64,116,751 N803S probably damaging Het
Vmn2r85 A G 10: 130,425,610 V286A probably benign Het
Wdr78 T A 4: 103,048,302 K761* probably null Het
Zbed3 T A 13: 95,336,491 L141Q probably damaging Het
Zfp623 T C 15: 75,948,313 C373R possibly damaging Het
Other mutations in Xdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Xdh APN 17 73923106 missense possibly damaging 0.58
IGL00556:Xdh APN 17 73884435 makesense probably null
IGL01524:Xdh APN 17 73923137 critical splice acceptor site probably null
IGL01604:Xdh APN 17 73909337 missense probably benign 0.02
IGL01625:Xdh APN 17 73916786 critical splice donor site probably null
IGL01778:Xdh APN 17 73900280 missense probably benign 0.00
IGL01804:Xdh APN 17 73892759 missense probably damaging 1.00
IGL01825:Xdh APN 17 73891245 missense probably damaging 1.00
IGL01929:Xdh APN 17 73934855 missense probably damaging 1.00
IGL02068:Xdh APN 17 73913950 missense probably damaging 1.00
IGL02079:Xdh APN 17 73891277 missense probably damaging 1.00
IGL02210:Xdh APN 17 73943895 missense probably benign 0.00
IGL02261:Xdh APN 17 73913965 missense possibly damaging 0.81
IGL02365:Xdh APN 17 73943890 missense probably benign 0.14
IGL02424:Xdh APN 17 73926570 missense probably benign 0.00
IGL02491:Xdh APN 17 73886464 missense probably damaging 0.99
IGL02525:Xdh APN 17 73924995 missense possibly damaging 0.91
IGL02578:Xdh APN 17 73906246 missense probably damaging 1.00
IGL02793:Xdh APN 17 73900581 missense probably damaging 1.00
IGL02939:Xdh APN 17 73943845 critical splice donor site probably null
IGL03327:Xdh APN 17 73916792 missense probably benign
IGL03345:Xdh APN 17 73906032 missense probably damaging 0.98
IGL03353:Xdh APN 17 73895786 missense possibly damaging 0.65
R0018:Xdh UTSW 17 73925025 missense probably benign 0.00
R0018:Xdh UTSW 17 73925025 missense probably benign 0.00
R0033:Xdh UTSW 17 73907632 missense probably benign 0.06
R0079:Xdh UTSW 17 73891218 missense probably damaging 1.00
R0086:Xdh UTSW 17 73884438 missense probably benign
R0319:Xdh UTSW 17 73906101 splice site probably benign
R0336:Xdh UTSW 17 73922463 missense possibly damaging 0.91
R0389:Xdh UTSW 17 73898362 missense probably damaging 1.00
R0684:Xdh UTSW 17 73943891 missense probably damaging 0.97
R0930:Xdh UTSW 17 73923082 missense probably benign 0.00
R1073:Xdh UTSW 17 73939836 missense probably benign
R1114:Xdh UTSW 17 73941149 splice site probably benign
R1201:Xdh UTSW 17 73918418 missense probably benign 0.05
R1230:Xdh UTSW 17 73891256 missense probably damaging 1.00
R1351:Xdh UTSW 17 73923078 missense probably benign 0.02
R1470:Xdh UTSW 17 73891112 missense probably damaging 1.00
R1470:Xdh UTSW 17 73891112 missense probably damaging 1.00
R1485:Xdh UTSW 17 73914019 nonsense probably null
R1548:Xdh UTSW 17 73913901 missense probably damaging 0.98
R1637:Xdh UTSW 17 73900578 missense probably benign
R1641:Xdh UTSW 17 73926552 missense probably benign
R1758:Xdh UTSW 17 73910209 missense probably damaging 1.00
R1951:Xdh UTSW 17 73907658 missense probably damaging 1.00
R1969:Xdh UTSW 17 73892751 missense possibly damaging 0.55
R2024:Xdh UTSW 17 73921305 missense possibly damaging 0.92
R2080:Xdh UTSW 17 73909325 missense probably damaging 1.00
R2157:Xdh UTSW 17 73922537 missense probably damaging 1.00
R2300:Xdh UTSW 17 73891265 missense probably damaging 1.00
R3783:Xdh UTSW 17 73893595 splice site probably benign
R3796:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3797:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3798:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3799:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3819:Xdh UTSW 17 73906725 missense probably benign 0.35
R4085:Xdh UTSW 17 73916879 missense probably benign 0.35
R4240:Xdh UTSW 17 73895795 missense possibly damaging 0.72
R4356:Xdh UTSW 17 73915690 missense probably benign 0.01
R4522:Xdh UTSW 17 73898344 missense probably damaging 1.00
R4523:Xdh UTSW 17 73898344 missense probably damaging 1.00
R4524:Xdh UTSW 17 73898344 missense probably damaging 1.00
R4600:Xdh UTSW 17 73910200 missense probably benign 0.19
R4617:Xdh UTSW 17 73918394 missense probably damaging 0.99
R4756:Xdh UTSW 17 73886386 missense probably benign 0.24
R4761:Xdh UTSW 17 73910267 missense possibly damaging 0.91
R4815:Xdh UTSW 17 73906215 missense probably damaging 1.00
R4850:Xdh UTSW 17 73898335 missense probably damaging 1.00
R4896:Xdh UTSW 17 73910243 missense probably damaging 0.96
R4897:Xdh UTSW 17 73900708 missense probably benign
R4923:Xdh UTSW 17 73924936 missense possibly damaging 0.72
R4977:Xdh UTSW 17 73898970 missense probably benign 0.05
R5030:Xdh UTSW 17 73891293 missense probably damaging 1.00
R5185:Xdh UTSW 17 73925011 missense probably damaging 1.00
R5347:Xdh UTSW 17 73925032 missense probably benign
R5556:Xdh UTSW 17 73897764 missense probably benign 0.21
R5566:Xdh UTSW 17 73893622 missense probably damaging 1.00
R5568:Xdh UTSW 17 73943885 missense possibly damaging 0.90
R5635:Xdh UTSW 17 73913875 missense possibly damaging 0.92
R5662:Xdh UTSW 17 73941115 missense probably damaging 0.99
R5955:Xdh UTSW 17 73898320 missense probably damaging 1.00
R6058:Xdh UTSW 17 73906269 missense probably damaging 1.00
R6061:Xdh UTSW 17 73921347 missense probably damaging 1.00
R6412:Xdh UTSW 17 73935907 missense probably benign 0.09
R6526:Xdh UTSW 17 73900551 missense probably damaging 0.97
R6558:Xdh UTSW 17 73893713 missense possibly damaging 0.95
R6843:Xdh UTSW 17 73923130 missense probably damaging 1.00
R6932:Xdh UTSW 17 73922562 missense probably damaging 0.99
R7028:Xdh UTSW 17 73943873 missense probably damaging 0.99
R7418:Xdh UTSW 17 73913965 missense possibly damaging 0.81
R7503:Xdh UTSW 17 73926210 missense probably damaging 1.00
R7653:Xdh UTSW 17 73897045 missense probably benign 0.10
R7763:Xdh UTSW 17 73934834 missense possibly damaging 0.69
R7768:Xdh UTSW 17 73939836 missense probably benign
R7904:Xdh UTSW 17 73922472 missense probably benign 0.09
R8010:Xdh UTSW 17 73909317 nonsense probably null
R8067:Xdh UTSW 17 73900657 missense probably benign 0.01
R8238:Xdh UTSW 17 73886417 missense probably benign
R8253:Xdh UTSW 17 73918382 missense possibly damaging 0.94
R8346:Xdh UTSW 17 73913943 missense probably damaging 1.00
R8350:Xdh UTSW 17 73934842 missense probably damaging 1.00
R8381:Xdh UTSW 17 73912461 missense probably benign
R8427:Xdh UTSW 17 73935931 missense probably damaging 1.00
R8465:Xdh UTSW 17 73899012 nonsense probably null
R8478:Xdh UTSW 17 73906058 missense probably benign 0.00
R8680:Xdh UTSW 17 73922505 missense probably benign
R8802:Xdh UTSW 17 73918410 missense probably benign 0.00
R8984:Xdh UTSW 17 73921351 missense probably damaging 1.00
R8985:Xdh UTSW 17 73921351 missense probably damaging 1.00
R8995:Xdh UTSW 17 73898374 missense probably damaging 1.00
X0019:Xdh UTSW 17 73918454 missense probably damaging 1.00
Z1088:Xdh UTSW 17 73886428 missense probably benign
Z1176:Xdh UTSW 17 73923042 critical splice donor site probably null
Z1177:Xdh UTSW 17 73897695 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGTCAACTGTAGTCAAATCTC -3'
(R):5'- TGTGAGAGGCTCATGGTCTC -3'

Sequencing Primer
(F):5'- ATCTCTATGTGCTACTCAAGTTGGAG -3'
(R):5'- GAGGCTCATGGTCTCAGTTAG -3'
Posted On2021-11-19