Incidental Mutation 'R9036:Ptprk'
ID 687407
Institutional Source Beutler Lab
Gene Symbol Ptprk
Ensembl Gene ENSMUSG00000019889
Gene Name protein tyrosine phosphatase, receptor type, K
Synonyms RPTPkappa, PTPk
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9036 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 28074820-28597397 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 28585932 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 1164 (I1164V)
Ref Sequence ENSEMBL: ENSMUSP00000151866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166468] [ENSMUST00000218276] [ENSMUST00000218359] [ENSMUST00000220357]
AlphaFold P35822
Predicted Effect probably benign
Transcript: ENSMUST00000166468
AA Change: I1150V

PolyPhen 2 Score 0.136 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000126279
Gene: ENSMUSG00000019889
AA Change: I1150V

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
MAM 30 193 1.61e-73 SMART
IG 200 288 2.16e-8 SMART
FN3 290 373 1.48e-4 SMART
FN3 389 475 4.24e1 SMART
FN3 491 579 3.32e-7 SMART
transmembrane domain 753 774 N/A INTRINSIC
PTPc 898 1161 3.56e-132 SMART
PTPc 1190 1455 2.68e-86 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000218276
AA Change: I1164V

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000218359
AA Change: I1138V

PolyPhen 2 Score 0.410 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000220357
AA Change: I79V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP mu (MAM) domain, an Ig-like domain and four fibronectin type III-like repeats. This PTP was shown to mediate homophilic intercellular interaction, possibly through the interaction with beta- and gamma-catenin at adherens junctions. Expression of this gene was found to be stimulated by TGF-beta 1, which may be important for the inhibition of keratinocyte proliferation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik C T 15: 8,223,138 T1948I possibly damaging Het
Acsl6 G T 11: 54,337,014 probably null Het
Anapc5 A G 5: 122,819,653 L69P possibly damaging Het
Arfgef1 A T 1: 10,188,830 S681T probably benign Het
Arhgef19 A G 4: 141,249,238 D437G probably damaging Het
Arhgef25 A G 10: 127,183,220 V576A probably benign Het
Arl5b T C 2: 15,068,201 probably null Het
Atg10 T A 13: 91,040,952 T80S probably benign Het
BC034090 A G 1: 155,241,673 V233A possibly damaging Het
Bicdl2 C T 17: 23,668,184 R482C probably damaging Het
Ccdc63 G A 5: 122,109,283 P500S probably benign Het
Ccng1 A T 11: 40,752,251 I123K possibly damaging Het
Ccp110 C T 7: 118,725,457 S734F probably damaging Het
Cds2 T C 2: 132,297,694 probably null Het
Cenpw G A 10: 30,198,527 T58I probably benign Het
Cfap61 T A 2: 146,008,919 L326I probably benign Het
Cgn T A 3: 94,767,241 Q862L possibly damaging Het
Cntrl T A 2: 35,126,059 D362E probably damaging Het
Col22a1 C T 15: 71,890,582 G76E probably damaging Het
Crip2 A G 12: 113,144,410 T140A probably benign Het
Csde1 T C 3: 103,043,660 V229A probably damaging Het
Ctgf A T 10: 24,596,749 T186S probably benign Het
Cyp2d34 A G 15: 82,616,322 F439L probably damaging Het
Dync1h1 A G 12: 110,639,752 T2419A probably benign Het
Dync2h1 A T 9: 7,051,495 F3147I probably damaging Het
Dynlt1f T C 17: 6,649,308 T101A probably benign Het
Efcab8 G A 2: 153,780,968 S19N Het
Eno2 A T 6: 124,763,128 I315K possibly damaging Het
Erich3 A G 3: 154,763,249 T1113A unknown Het
Fam217a A T 13: 34,911,024 Y251N possibly damaging Het
Fcrlb A T 1: 170,907,369 H396Q probably benign Het
Fgd5 A T 6: 92,069,466 K1397* probably null Het
Frem1 C A 4: 82,913,548 L2010F probably benign Het
Fuk A G 8: 110,887,432 V693A probably benign Het
Fzd8 A G 18: 9,214,661 Y581C probably damaging Het
Gcc2 T C 10: 58,270,589 V549A possibly damaging Het
Gcnt4 G A 13: 96,946,534 V113I probably benign Het
Gldn A G 9: 54,338,463 I433V probably benign Het
Gm11639 A G 11: 105,036,775 H4790R probably benign Het
Gm3336 A G 8: 70,720,420 D27G unknown Het
Gm6133 T A 18: 78,349,931 Y47N probably damaging Het
Gm8257 A T 14: 44,656,420 N62K probably benign Het
Gm9833 C A 3: 10,092,281 Q495K unknown Het
Gpr18 T G 14: 121,912,255 R119S probably damaging Het
Grm5 A T 7: 88,036,189 I505F possibly damaging Het
Hdgfl1 T C 13: 26,769,445 E215G probably benign Het
Heg1 T A 16: 33,706,969 C100S probably benign Het
Isg20l2 T C 3: 87,931,995 V171A probably benign Het
Lrrc49 A T 9: 60,587,867 C694S probably benign Het
Map7d1 A T 4: 126,240,118 I217N probably damaging Het
Mbnl2 A T 14: 120,325,300 Q21L probably benign Het
Mfsd10 A T 5: 34,635,407 F220Y probably benign Het
Mmp1b A C 9: 7,387,909 N28K probably null Het
Muc16 A T 9: 18,644,679 N3439K unknown Het
Myo9a A T 9: 59,780,301 K230* probably null Het
Mysm1 T C 4: 94,947,057 T790A probably benign Het
Nell2 C T 15: 95,296,236 C532Y probably damaging Het
Nmnat1 T A 4: 149,469,025 N210I probably damaging Het
Olfr128 T G 17: 37,924,277 V237G probably benign Het
Olfr1287 T C 2: 111,449,998 I286T probably damaging Het
Olfr171 A T 16: 19,624,545 L185* probably null Het
Olfr828 G A 9: 18,816,273 T7I probably damaging Het
Pabpc6 T C 17: 9,669,352 D90G probably damaging Het
Pacs2 A T 12: 113,062,484 I554F possibly damaging Het
Padi3 C A 4: 140,795,693 V323L probably benign Het
Piezo1 G A 8: 122,488,351 P1484L Het
Pogk A G 1: 166,399,685 I299T possibly damaging Het
Raph1 A G 1: 60,502,965 M278T unknown Het
Rasa3 T A 8: 13,595,851 Q163L probably benign Het
Rbm6 T A 9: 107,783,712 K884I probably damaging Het
Rtl1 A G 12: 109,593,257 V716A probably benign Het
Sag A G 1: 87,821,332 K151R probably damaging Het
Scara5 G A 14: 65,762,748 V456M probably benign Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Slc4a1 A T 11: 102,352,453 V784D probably damaging Het
Sstr1 T C 12: 58,212,783 I64T possibly damaging Het
Steap1 A G 5: 5,740,708 I80T probably benign Het
Svs1 CCTAAATTTCCTATCCCGATCAGCAAGGGTGGCCCTCGAGTGCCCCAGCCCCATGCTAAATTTCC CCTAAATTTCC 6: 48,988,140 probably benign Het
Tbc1d24 T A 17: 24,208,517 D157V probably benign Het
Thsd7a T C 6: 12,418,250 E660G Het
Trappc3l A G 10: 34,056,790 probably benign Het
Tsc22d2 T C 3: 58,416,076 S130P probably benign Het
Tti2 T A 8: 31,155,786 I376N probably damaging Het
Ttll2 C A 17: 7,351,655 W291L probably benign Het
Ttll3 G A 6: 113,399,696 V345I possibly damaging Het
Ttn A G 2: 76,734,702 Y28394H probably damaging Het
Usp45 A G 4: 21,832,201 Y684C probably damaging Het
Vdr A G 15: 97,867,208 S217P probably benign Het
Xpot A G 10: 121,611,675 L105P probably damaging Het
Zan A G 5: 137,465,944 I533T probably damaging Het
Zbtb8a T C 4: 129,354,266 E404G probably benign Het
Zfp106 T A 2: 120,539,425 I62F probably damaging Het
Zfp451 A T 1: 33,776,481 F796Y probably damaging Het
Other mutations in Ptprk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00310:Ptprk APN 10 28336510 missense possibly damaging 0.92
IGL00533:Ptprk APN 10 28585975 missense probably damaging 0.97
IGL01062:Ptprk APN 10 28580418 missense probably damaging 1.00
IGL01295:Ptprk APN 10 28475178 missense probably benign 0.14
IGL01372:Ptprk APN 10 28569927 missense probably benign 0.00
IGL01452:Ptprk APN 10 28574917 critical splice donor site probably null
IGL01829:Ptprk APN 10 28573387 missense probably damaging 1.00
IGL01861:Ptprk APN 10 28383445 missense possibly damaging 0.80
IGL01955:Ptprk APN 10 28595865 unclassified probably benign
IGL02263:Ptprk APN 10 28075114 missense unknown
IGL02489:Ptprk APN 10 28383472 missense probably damaging 1.00
IGL02697:Ptprk APN 10 28575618 missense possibly damaging 0.85
IGL02713:Ptprk APN 10 28592811 missense possibly damaging 0.92
IGL02943:Ptprk APN 10 28475176 missense possibly damaging 0.81
IGL03240:Ptprk APN 10 28492961 missense probably damaging 0.99
IGL03373:Ptprk APN 10 28566537 missense probably damaging 1.00
LCD18:Ptprk UTSW 10 28574987 intron probably benign
PIT4366001:Ptprk UTSW 10 28586019 missense probably benign
R0010:Ptprk UTSW 10 28585969 missense probably damaging 1.00
R0021:Ptprk UTSW 10 28592895 missense probably damaging 1.00
R0021:Ptprk UTSW 10 28592895 missense probably damaging 1.00
R0035:Ptprk UTSW 10 28263508 nonsense probably null
R0035:Ptprk UTSW 10 28263508 nonsense probably null
R0053:Ptprk UTSW 10 28475109 missense probably damaging 0.99
R0063:Ptprk UTSW 10 28263767 missense probably damaging 1.00
R0063:Ptprk UTSW 10 28263767 missense probably damaging 1.00
R0244:Ptprk UTSW 10 28206225 missense possibly damaging 0.79
R0281:Ptprk UTSW 10 28573392 missense probably damaging 1.00
R0387:Ptprk UTSW 10 28354629 missense possibly damaging 0.66
R0480:Ptprk UTSW 10 28585947 missense probably damaging 1.00
R0480:Ptprk UTSW 10 28585948 missense probably damaging 1.00
R0585:Ptprk UTSW 10 28575668 missense probably damaging 1.00
R0614:Ptprk UTSW 10 28075136 missense probably damaging 0.96
R0684:Ptprk UTSW 10 28483298 splice site probably benign
R1073:Ptprk UTSW 10 28496947 critical splice donor site probably null
R1377:Ptprk UTSW 10 28586026 missense probably benign 0.42
R1422:Ptprk UTSW 10 28475280 missense possibly damaging 0.64
R1482:Ptprk UTSW 10 28263516 missense probably benign 0.24
R1532:Ptprk UTSW 10 28585630 missense probably damaging 1.00
R1576:Ptprk UTSW 10 28551651 missense probably damaging 1.00
R1618:Ptprk UTSW 10 28493170 missense probably benign 0.00
R1654:Ptprk UTSW 10 28383647 missense probably damaging 1.00
R1701:Ptprk UTSW 10 28466058 missense probably damaging 1.00
R1747:Ptprk UTSW 10 28354692 missense possibly damaging 0.78
R2033:Ptprk UTSW 10 28592767 unclassified probably benign
R2059:Ptprk UTSW 10 28566603 missense probably damaging 1.00
R2076:Ptprk UTSW 10 28589368 missense probably damaging 0.98
R2164:Ptprk UTSW 10 28560142 missense probably damaging 1.00
R2260:Ptprk UTSW 10 28206149 missense possibly damaging 0.65
R2394:Ptprk UTSW 10 28551717 missense probably damaging 0.98
R2432:Ptprk UTSW 10 28592844 missense probably damaging 1.00
R2437:Ptprk UTSW 10 28354713 missense probably damaging 1.00
R2495:Ptprk UTSW 10 28475078 splice site probably benign
R3037:Ptprk UTSW 10 28580478 missense probably damaging 1.00
R3162:Ptprk UTSW 10 28592826 missense probably benign
R3162:Ptprk UTSW 10 28592826 missense probably benign
R3687:Ptprk UTSW 10 28473043 missense probably damaging 1.00
R3722:Ptprk UTSW 10 28383623 missense probably damaging 1.00
R3892:Ptprk UTSW 10 28263621 missense probably benign 0.02
R3963:Ptprk UTSW 10 28551665 missense probably damaging 0.99
R4077:Ptprk UTSW 10 28263512 missense probably benign
R4079:Ptprk UTSW 10 28263512 missense probably benign
R4112:Ptprk UTSW 10 28475288 critical splice donor site probably null
R4255:Ptprk UTSW 10 28206245 missense probably benign 0.14
R4523:Ptprk UTSW 10 28466052 missense probably damaging 0.99
R4651:Ptprk UTSW 10 28263690 missense probably damaging 0.99
R4652:Ptprk UTSW 10 28263690 missense probably damaging 0.99
R4828:Ptprk UTSW 10 28560054 missense probably damaging 1.00
R4829:Ptprk UTSW 10 28580484 nonsense probably null
R4883:Ptprk UTSW 10 28588932 missense probably damaging 1.00
R5004:Ptprk UTSW 10 28586063 missense possibly damaging 0.95
R5013:Ptprk UTSW 10 28551717 missense probably damaging 0.99
R5092:Ptprk UTSW 10 28592773 missense probably damaging 1.00
R5126:Ptprk UTSW 10 28575644 splice site probably null
R5183:Ptprk UTSW 10 28475236 missense probably benign 0.02
R5264:Ptprk UTSW 10 28585586 missense probably damaging 1.00
R5304:Ptprk UTSW 10 28592054 splice site probably null
R5330:Ptprk UTSW 10 28587080 missense probably damaging 1.00
R5474:Ptprk UTSW 10 28496930 nonsense probably null
R5516:Ptprk UTSW 10 28496930 nonsense probably null
R5796:Ptprk UTSW 10 28383575 missense probably damaging 1.00
R5843:Ptprk UTSW 10 28493064 missense probably damaging 0.99
R5952:Ptprk UTSW 10 28585675 missense probably damaging 0.99
R6065:Ptprk UTSW 10 28475170 missense probably damaging 1.00
R6226:Ptprk UTSW 10 28564103 missense probably benign 0.02
R6264:Ptprk UTSW 10 28566673 missense probably damaging 1.00
R6638:Ptprk UTSW 10 28595811 missense probably damaging 1.00
R6843:Ptprk UTSW 10 28591982 missense possibly damaging 0.86
R6860:Ptprk UTSW 10 28334484 missense probably damaging 1.00
R6869:Ptprk UTSW 10 28473059 critical splice donor site probably null
R7214:Ptprk UTSW 10 28574909 missense probably benign 0.11
R7307:Ptprk UTSW 10 28589008 nonsense probably null
R7349:Ptprk UTSW 10 28592838 missense possibly damaging 0.85
R7442:Ptprk UTSW 10 28574819 missense probably damaging 1.00
R7585:Ptprk UTSW 10 28560088 missense probably damaging 1.00
R7661:Ptprk UTSW 10 28466040 missense probably benign 0.00
R7694:Ptprk UTSW 10 28589370 missense possibly damaging 0.63
R7740:Ptprk UTSW 10 28496924 missense probably damaging 1.00
R7810:Ptprk UTSW 10 28592857 missense probably damaging 0.97
R7831:Ptprk UTSW 10 28568408 missense possibly damaging 0.89
R7836:Ptprk UTSW 10 28573389 missense probably damaging 1.00
R8049:Ptprk UTSW 10 28383569 missense possibly damaging 0.84
R8235:Ptprk UTSW 10 28589041 missense possibly damaging 0.70
R8274:Ptprk UTSW 10 28580412 missense probably damaging 1.00
R8286:Ptprk UTSW 10 28568327 missense probably damaging 1.00
R8372:Ptprk UTSW 10 28354692 missense possibly damaging 0.78
R8727:Ptprk UTSW 10 28566545 unclassified probably benign
R8794:Ptprk UTSW 10 28263508 nonsense probably null
R8842:Ptprk UTSW 10 28566501 missense probably damaging 0.97
R8861:Ptprk UTSW 10 28570190 missense probably damaging 1.00
R8897:Ptprk UTSW 10 28591957 missense probably damaging 1.00
R8910:Ptprk UTSW 10 28492997 missense possibly damaging 0.68
R8919:Ptprk UTSW 10 28483207 nonsense probably null
R8976:Ptprk UTSW 10 28585673 missense probably damaging 1.00
R8982:Ptprk UTSW 10 28560142 missense probably damaging 1.00
R9135:Ptprk UTSW 10 28580417 missense probably damaging 1.00
R9308:Ptprk UTSW 10 28574854 missense probably benign 0.15
R9317:Ptprk UTSW 10 28354735 missense probably damaging 0.96
Z1177:Ptprk UTSW 10 28493120 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGACAGAGGTAAACTGATTTGC -3'
(R):5'- GCCCAGTACAAATTGGAAAGAC -3'

Sequencing Primer
(F):5'- GTGTCTACCATATACCAAATGGGAC -3'
(R):5'- GACTTTCATAGAAACCTTAGAAGCAG -3'
Posted On 2021-11-19