Incidental Mutation 'R9037:Ints2'
ID 687481
Institutional Source Beutler Lab
Gene Symbol Ints2
Ensembl Gene ENSMUSG00000018068
Gene Name integrator complex subunit 2
Synonyms 2810417D08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9037 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 86210681-86257575 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 86215704 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 960 (T960I)
Ref Sequence ENSEMBL: ENSMUSP00000018212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018212] [ENSMUST00000108039]
AlphaFold Q80UK8
Predicted Effect probably benign
Transcript: ENSMUST00000018212
AA Change: T960I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000018212
Gene: ENSMUSG00000018068
AA Change: T960I

DomainStartEndE-ValueType
Pfam:INTS2 24 1131 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108039
AA Change: T960I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103674
Gene: ENSMUSG00000018068
AA Change: T960I

DomainStartEndE-ValueType
Pfam:INTS2 24 1132 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134828
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS2 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim3 T A 18: 61,818,995 I432F probably benign Het
Aco2 C G 15: 81,872,419 probably benign Het
Adcy1 A G 11: 7,137,325 T400A possibly damaging Het
Afap1l2 A T 19: 56,929,971 probably benign Het
Anapc4 C A 5: 52,864,501 Q642K probably benign Het
Ano8 A G 8: 71,484,444 F160S probably damaging Het
Apob T C 12: 8,016,501 V4490A probably benign Het
Bcar1 A C 8: 111,720,890 F152V probably benign Het
Cacna2d2 A G 9: 107,509,196 D174G probably benign Het
Capn11 T C 17: 45,639,431 K328R probably benign Het
Colq C A 14: 31,557,787 probably benign Het
Coro1a A C 7: 126,700,600 M350R probably benign Het
Ctbp1 T A 5: 33,267,008 M24L probably benign Het
Cyp2c55 T A 19: 39,042,093 F456L probably damaging Het
Dnah5 A T 15: 28,247,958 K747M probably benign Het
Esp36 C T 17: 38,418,949 G60D unknown Het
Gast A G 11: 100,336,610 E43G probably damaging Het
Gm11639 A G 11: 104,912,965 D3048G unknown Het
Gm5849 T G 3: 90,777,848 N10T probably benign Het
Gm8765 A G 13: 50,702,908 K861E probably benign Het
Gulp1 T C 1: 44,754,364 S62P probably benign Het
Hectd1 T C 12: 51,785,882 D903G possibly damaging Het
Hk2 T A 6: 82,743,358 I201F probably benign Het
Ifna2 T C 4: 88,683,427 D118G probably benign Het
Ift172 T C 5: 31,263,056 K1079E possibly damaging Het
Igsf9 T C 1: 172,484,514 V9A probably benign Het
Klk12 T C 7: 43,769,715 W35R probably damaging Het
Ly6c1 C A 15: 75,045,451 G116V probably damaging Het
Macf1 T C 4: 123,471,725 N3081S probably benign Het
Mal2 A G 15: 54,571,543 N12S unknown Het
Mgat1 T G 11: 49,261,429 N246K probably damaging Het
Mpeg1 T A 19: 12,461,826 V216E probably damaging Het
Mpo A G 11: 87,797,731 probably benign Het
Mtmr9 T A 14: 63,524,083 T541S possibly damaging Het
Olfr1047 G T 2: 86,228,698 T91K probably benign Het
Olfr1246 C T 2: 89,590,707 R136Q probably benign Het
Olfr623 T A 7: 103,661,175 H25L probably benign Het
Olfr995 T C 2: 85,438,795 D121G possibly damaging Het
P2rx6 A G 16: 17,570,443 T328A possibly damaging Het
Pcdhb12 A C 18: 37,436,176 E125A probably benign Het
Pde3a C A 6: 141,471,106 Q569K probably damaging Het
Pepd A T 7: 35,020,973 Q227L probably benign Het
Piezo2 T A 18: 63,092,831 E911D probably benign Het
Pnpla6 A T 8: 3,542,379 R1241* probably null Het
Pold1 T C 7: 44,538,915 D513G probably damaging Het
Polr1d A T 5: 147,078,680 I58L probably benign Het
Ppif T C 14: 25,694,404 L58P probably damaging Het
Preb T C 5: 30,959,246 K101R probably benign Het
Psma8 G T 18: 14,721,194 V44L probably benign Het
Ptf1a A G 2: 19,446,225 Y122C possibly damaging Het
Ranbp6 T C 19: 29,812,917 T12A probably benign Het
Rasal3 C A 17: 32,395,120 R587L probably benign Het
Rnf146 T C 10: 29,347,680 K70R probably benign Het
Serpinb6b G T 13: 32,978,015 E266* probably null Het
Slc15a2 A T 16: 36,762,363 M252K probably benign Het
Slc2a1 T C 4: 119,136,297 F444L probably damaging Het
Sox9 A G 11: 112,784,824 S280G probably damaging Het
Trappc8 A G 18: 20,828,482 V1243A probably benign Het
Trpv2 A T 11: 62,584,405 T215S probably damaging Het
Ttc39a A G 4: 109,442,784 E490G probably damaging Het
Ush2a A T 1: 188,263,290 D86V possibly damaging Het
Usp24 A G 4: 106,379,054 T980A probably damaging Het
Vwa7 T C 17: 35,017,292 V74A probably benign Het
Zan A G 5: 137,454,316 V1501A unknown Het
Zfp105 A G 9: 122,929,771 E169G possibly damaging Het
Zfp788 C T 7: 41,648,891 T317I probably damaging Het
Other mutations in Ints2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00807:Ints2 APN 11 86233135 missense probably damaging 1.00
IGL02490:Ints2 APN 11 86233183 missense possibly damaging 0.93
IGL02612:Ints2 APN 11 86215578 missense probably damaging 1.00
IGL03396:Ints2 APN 11 86213062 missense probably damaging 0.99
R0015:Ints2 UTSW 11 86249287 missense probably damaging 1.00
R0015:Ints2 UTSW 11 86249287 missense probably damaging 1.00
R0355:Ints2 UTSW 11 86234749 missense probably benign 0.00
R0389:Ints2 UTSW 11 86248851 missense probably damaging 1.00
R0631:Ints2 UTSW 11 86233196 missense probably benign 0.02
R0944:Ints2 UTSW 11 86244463 missense possibly damaging 0.85
R1268:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R1269:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R1270:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R1396:Ints2 UTSW 11 86249248 missense probably damaging 0.98
R1474:Ints2 UTSW 11 86226781 missense probably damaging 0.97
R1503:Ints2 UTSW 11 86226781 missense probably damaging 0.97
R1840:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R1987:Ints2 UTSW 11 86217800 missense probably benign 0.03
R1990:Ints2 UTSW 11 86248934 missense possibly damaging 0.58
R1991:Ints2 UTSW 11 86248934 missense possibly damaging 0.58
R3694:Ints2 UTSW 11 86243001 missense probably benign 0.41
R4056:Ints2 UTSW 11 86242952 missense probably damaging 1.00
R4057:Ints2 UTSW 11 86242952 missense probably damaging 1.00
R4569:Ints2 UTSW 11 86256198 missense probably damaging 1.00
R4585:Ints2 UTSW 11 86249275 missense probably damaging 1.00
R4586:Ints2 UTSW 11 86249275 missense probably damaging 1.00
R4806:Ints2 UTSW 11 86256209 missense probably benign 0.10
R4929:Ints2 UTSW 11 86212653 missense possibly damaging 0.56
R5031:Ints2 UTSW 11 86256200 missense probably damaging 1.00
R5064:Ints2 UTSW 11 86249274 missense probably damaging 1.00
R5270:Ints2 UTSW 11 86215795 missense probably damaging 1.00
R5621:Ints2 UTSW 11 86242947 missense probably benign 0.32
R5875:Ints2 UTSW 11 86238312 missense probably benign 0.04
R5908:Ints2 UTSW 11 86215545 critical splice donor site probably null
R5914:Ints2 UTSW 11 86222174 missense probably benign 0.03
R5941:Ints2 UTSW 11 86250972 missense probably benign 0.01
R5975:Ints2 UTSW 11 86226748 missense possibly damaging 0.72
R6003:Ints2 UTSW 11 86238468 missense probably damaging 1.00
R6091:Ints2 UTSW 11 86236603 missense probably damaging 0.96
R6209:Ints2 UTSW 11 86225058 missense probably damaging 1.00
R6567:Ints2 UTSW 11 86226661 missense probably benign 0.42
R6764:Ints2 UTSW 11 86212779 missense probably benign 0.00
R7033:Ints2 UTSW 11 86233085 missense probably damaging 1.00
R7132:Ints2 UTSW 11 86217754 missense probably benign 0.26
R7337:Ints2 UTSW 11 86217842 missense probably benign 0.00
R7410:Ints2 UTSW 11 86233226 missense probably benign 0.02
R7483:Ints2 UTSW 11 86215618 missense probably damaging 1.00
R7503:Ints2 UTSW 11 86232055 missense probably benign
R7804:Ints2 UTSW 11 86212663 missense possibly damaging 0.92
R7845:Ints2 UTSW 11 86238263 missense possibly damaging 0.93
R7875:Ints2 UTSW 11 86213062 missense probably damaging 0.99
R7918:Ints2 UTSW 11 86222217 missense probably damaging 1.00
R7922:Ints2 UTSW 11 86244627 missense probably benign 0.29
R8058:Ints2 UTSW 11 86255353 missense probably benign 0.05
R8134:Ints2 UTSW 11 86212660 missense probably damaging 1.00
R8189:Ints2 UTSW 11 86215570 missense probably damaging 1.00
R8295:Ints2 UTSW 11 86225088 missense probably damaging 0.97
R8348:Ints2 UTSW 11 86255423 missense probably benign
R8448:Ints2 UTSW 11 86255423 missense probably benign
R8784:Ints2 UTSW 11 86222137 missense probably damaging 1.00
R8784:Ints2 UTSW 11 86225115 nonsense probably null
R8942:Ints2 UTSW 11 86212894 missense probably benign 0.00
R9154:Ints2 UTSW 11 86234698 missense probably damaging 1.00
R9397:Ints2 UTSW 11 86244485 missense probably benign 0.01
R9412:Ints2 UTSW 11 86226763 missense probably damaging 0.99
R9472:Ints2 UTSW 11 86242998 missense
R9476:Ints2 UTSW 11 86244509 missense probably benign
R9510:Ints2 UTSW 11 86244509 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGGCGCATACCTGAAAGTG -3'
(R):5'- AGACCCTCTGCATTGTTAACC -3'

Sequencing Primer
(F):5'- GAACAAGTTTAGCAATGTTGGGATC -3'
(R):5'- GCCATTCTGTTCATATGAAAATCGGG -3'
Posted On 2021-11-19