Incidental Mutation 'R9037:Ints2'
ID 687481
Institutional Source Beutler Lab
Gene Symbol Ints2
Ensembl Gene ENSMUSG00000018068
Gene Name integrator complex subunit 2
Synonyms 2810417D08Rik
MMRRC Submission 068969-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9037 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 86101507-86148401 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 86106530 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 960 (T960I)
Ref Sequence ENSEMBL: ENSMUSP00000018212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018212] [ENSMUST00000108039]
AlphaFold Q80UK8
Predicted Effect probably benign
Transcript: ENSMUST00000018212
AA Change: T960I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000018212
Gene: ENSMUSG00000018068
AA Change: T960I

DomainStartEndE-ValueType
Pfam:INTS2 24 1131 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108039
AA Change: T960I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103674
Gene: ENSMUSG00000018068
AA Change: T960I

DomainStartEndE-ValueType
Pfam:INTS2 24 1132 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134828
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS2 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim3 T A 18: 61,952,066 (GRCm39) I432F probably benign Het
Aco2 C G 15: 81,756,620 (GRCm39) probably benign Het
Adcy1 A G 11: 7,087,325 (GRCm39) T400A possibly damaging Het
Afap1l2 A T 19: 56,918,403 (GRCm39) probably benign Het
Anapc4 C A 5: 53,021,843 (GRCm39) Q642K probably benign Het
Ano8 A G 8: 71,937,088 (GRCm39) F160S probably damaging Het
Apob T C 12: 8,066,501 (GRCm39) V4490A probably benign Het
Bcar1 A C 8: 112,447,522 (GRCm39) F152V probably benign Het
Cacna2d2 A G 9: 107,386,395 (GRCm39) D174G probably benign Het
Capn11 T C 17: 45,950,357 (GRCm39) K328R probably benign Het
Colq C A 14: 31,279,744 (GRCm39) probably benign Het
Coro1a A C 7: 126,299,772 (GRCm39) M350R probably benign Het
Ctbp1 T A 5: 33,424,352 (GRCm39) M24L probably benign Het
Cyp2c55 T A 19: 39,030,537 (GRCm39) F456L probably damaging Het
Dnah5 A T 15: 28,248,104 (GRCm39) K747M probably benign Het
Efcab3 A G 11: 104,803,791 (GRCm39) D3048G unknown Het
Esp36 C T 17: 38,729,840 (GRCm39) G60D unknown Het
Gast A G 11: 100,227,436 (GRCm39) E43G probably damaging Het
Gm5849 T G 3: 90,685,155 (GRCm39) N10T probably benign Het
Gulp1 T C 1: 44,793,524 (GRCm39) S62P probably benign Het
Hectd1 T C 12: 51,832,665 (GRCm39) D903G possibly damaging Het
Hk2 T A 6: 82,720,339 (GRCm39) I201F probably benign Het
Ifna2 T C 4: 88,601,664 (GRCm39) D118G probably benign Het
Ift172 T C 5: 31,420,400 (GRCm39) K1079E possibly damaging Het
Igsf9 T C 1: 172,312,081 (GRCm39) V9A probably benign Het
Klk12 T C 7: 43,419,139 (GRCm39) W35R probably damaging Het
Ly6c1 C A 15: 74,917,300 (GRCm39) G116V probably damaging Het
Macf1 T C 4: 123,365,518 (GRCm39) N3081S probably benign Het
Mal2 A G 15: 54,434,939 (GRCm39) N12S unknown Het
Mgat1 T G 11: 49,152,256 (GRCm39) N246K probably damaging Het
Mpeg1 T A 19: 12,439,190 (GRCm39) V216E probably damaging Het
Mpo A G 11: 87,688,557 (GRCm39) probably benign Het
Mtmr9 T A 14: 63,761,532 (GRCm39) T541S possibly damaging Het
Or4a73 C T 2: 89,421,051 (GRCm39) R136Q probably benign Het
Or51b6b T A 7: 103,310,382 (GRCm39) H25L probably benign Het
Or5ak25 T C 2: 85,269,139 (GRCm39) D121G possibly damaging Het
Or8k3 G T 2: 86,059,042 (GRCm39) T91K probably benign Het
P2rx6 A G 16: 17,388,307 (GRCm39) T328A possibly damaging Het
Pcdhb12 A C 18: 37,569,229 (GRCm39) E125A probably benign Het
Pde3a C A 6: 141,416,832 (GRCm39) Q569K probably damaging Het
Pepd A T 7: 34,720,398 (GRCm39) Q227L probably benign Het
Piezo2 T A 18: 63,225,902 (GRCm39) E911D probably benign Het
Pnpla6 A T 8: 3,592,379 (GRCm39) R1241* probably null Het
Pold1 T C 7: 44,188,339 (GRCm39) D513G probably damaging Het
Polr1d A T 5: 147,015,490 (GRCm39) I58L probably benign Het
Ppif T C 14: 25,694,828 (GRCm39) L58P probably damaging Het
Preb T C 5: 31,116,590 (GRCm39) K101R probably benign Het
Psma8 G T 18: 14,854,251 (GRCm39) V44L probably benign Het
Ptf1a A G 2: 19,451,036 (GRCm39) Y122C possibly damaging Het
Ranbp6 T C 19: 29,790,317 (GRCm39) T12A probably benign Het
Rasal3 C A 17: 32,614,094 (GRCm39) R587L probably benign Het
Rnf146 T C 10: 29,223,676 (GRCm39) K70R probably benign Het
Serpinb6b G T 13: 33,161,998 (GRCm39) E266* probably null Het
Slc15a2 A T 16: 36,582,725 (GRCm39) M252K probably benign Het
Slc2a1 T C 4: 118,993,494 (GRCm39) F444L probably damaging Het
Sox9 A G 11: 112,675,650 (GRCm39) S280G probably damaging Het
Spata31e4 A G 13: 50,856,944 (GRCm39) K861E probably benign Het
Trappc8 A G 18: 20,961,539 (GRCm39) V1243A probably benign Het
Trpv2 A T 11: 62,475,231 (GRCm39) T215S probably damaging Het
Ttc39a A G 4: 109,299,981 (GRCm39) E490G probably damaging Het
Ush2a A T 1: 187,995,487 (GRCm39) D86V possibly damaging Het
Usp24 A G 4: 106,236,251 (GRCm39) T980A probably damaging Het
Vwa7 T C 17: 35,236,268 (GRCm39) V74A probably benign Het
Zan A G 5: 137,452,578 (GRCm39) V1501A unknown Het
Zfp105 A G 9: 122,758,836 (GRCm39) E169G possibly damaging Het
Zfp788 C T 7: 41,298,315 (GRCm39) T317I probably damaging Het
Other mutations in Ints2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00807:Ints2 APN 11 86,123,961 (GRCm39) missense probably damaging 1.00
IGL02490:Ints2 APN 11 86,124,009 (GRCm39) missense possibly damaging 0.93
IGL02612:Ints2 APN 11 86,106,404 (GRCm39) missense probably damaging 1.00
IGL03396:Ints2 APN 11 86,103,888 (GRCm39) missense probably damaging 0.99
R0015:Ints2 UTSW 11 86,140,113 (GRCm39) missense probably damaging 1.00
R0015:Ints2 UTSW 11 86,140,113 (GRCm39) missense probably damaging 1.00
R0355:Ints2 UTSW 11 86,125,575 (GRCm39) missense probably benign 0.00
R0389:Ints2 UTSW 11 86,139,677 (GRCm39) missense probably damaging 1.00
R0631:Ints2 UTSW 11 86,124,022 (GRCm39) missense probably benign 0.02
R0944:Ints2 UTSW 11 86,135,289 (GRCm39) missense possibly damaging 0.85
R1268:Ints2 UTSW 11 86,123,911 (GRCm39) missense probably damaging 1.00
R1269:Ints2 UTSW 11 86,123,911 (GRCm39) missense probably damaging 1.00
R1270:Ints2 UTSW 11 86,123,911 (GRCm39) missense probably damaging 1.00
R1396:Ints2 UTSW 11 86,140,074 (GRCm39) missense probably damaging 0.98
R1474:Ints2 UTSW 11 86,117,607 (GRCm39) missense probably damaging 0.97
R1503:Ints2 UTSW 11 86,117,607 (GRCm39) missense probably damaging 0.97
R1840:Ints2 UTSW 11 86,123,911 (GRCm39) missense probably damaging 1.00
R1987:Ints2 UTSW 11 86,108,626 (GRCm39) missense probably benign 0.03
R1990:Ints2 UTSW 11 86,139,760 (GRCm39) missense possibly damaging 0.58
R1991:Ints2 UTSW 11 86,139,760 (GRCm39) missense possibly damaging 0.58
R3694:Ints2 UTSW 11 86,133,827 (GRCm39) missense probably benign 0.41
R4056:Ints2 UTSW 11 86,133,778 (GRCm39) missense probably damaging 1.00
R4057:Ints2 UTSW 11 86,133,778 (GRCm39) missense probably damaging 1.00
R4569:Ints2 UTSW 11 86,147,024 (GRCm39) missense probably damaging 1.00
R4585:Ints2 UTSW 11 86,140,101 (GRCm39) missense probably damaging 1.00
R4586:Ints2 UTSW 11 86,140,101 (GRCm39) missense probably damaging 1.00
R4806:Ints2 UTSW 11 86,147,035 (GRCm39) missense probably benign 0.10
R4929:Ints2 UTSW 11 86,103,479 (GRCm39) missense possibly damaging 0.56
R5031:Ints2 UTSW 11 86,147,026 (GRCm39) missense probably damaging 1.00
R5064:Ints2 UTSW 11 86,140,100 (GRCm39) missense probably damaging 1.00
R5270:Ints2 UTSW 11 86,106,621 (GRCm39) missense probably damaging 1.00
R5621:Ints2 UTSW 11 86,133,773 (GRCm39) missense probably benign 0.32
R5875:Ints2 UTSW 11 86,129,138 (GRCm39) missense probably benign 0.04
R5908:Ints2 UTSW 11 86,106,371 (GRCm39) critical splice donor site probably null
R5914:Ints2 UTSW 11 86,113,000 (GRCm39) missense probably benign 0.03
R5941:Ints2 UTSW 11 86,141,798 (GRCm39) missense probably benign 0.01
R5975:Ints2 UTSW 11 86,117,574 (GRCm39) missense possibly damaging 0.72
R6003:Ints2 UTSW 11 86,129,294 (GRCm39) missense probably damaging 1.00
R6091:Ints2 UTSW 11 86,127,429 (GRCm39) missense probably damaging 0.96
R6209:Ints2 UTSW 11 86,115,884 (GRCm39) missense probably damaging 1.00
R6567:Ints2 UTSW 11 86,117,487 (GRCm39) missense probably benign 0.42
R6764:Ints2 UTSW 11 86,103,605 (GRCm39) missense probably benign 0.00
R7033:Ints2 UTSW 11 86,123,911 (GRCm39) missense probably damaging 1.00
R7132:Ints2 UTSW 11 86,108,580 (GRCm39) missense probably benign 0.26
R7337:Ints2 UTSW 11 86,108,668 (GRCm39) missense probably benign 0.00
R7410:Ints2 UTSW 11 86,124,052 (GRCm39) missense probably benign 0.02
R7483:Ints2 UTSW 11 86,106,444 (GRCm39) missense probably damaging 1.00
R7503:Ints2 UTSW 11 86,122,881 (GRCm39) missense probably benign
R7804:Ints2 UTSW 11 86,103,489 (GRCm39) missense possibly damaging 0.92
R7845:Ints2 UTSW 11 86,129,089 (GRCm39) missense possibly damaging 0.93
R7875:Ints2 UTSW 11 86,103,888 (GRCm39) missense probably damaging 0.99
R7918:Ints2 UTSW 11 86,113,043 (GRCm39) missense probably damaging 1.00
R7922:Ints2 UTSW 11 86,135,453 (GRCm39) missense probably benign 0.29
R8058:Ints2 UTSW 11 86,146,179 (GRCm39) missense probably benign 0.05
R8134:Ints2 UTSW 11 86,103,486 (GRCm39) missense probably damaging 1.00
R8189:Ints2 UTSW 11 86,106,396 (GRCm39) missense probably damaging 1.00
R8295:Ints2 UTSW 11 86,115,914 (GRCm39) missense probably damaging 0.97
R8348:Ints2 UTSW 11 86,146,249 (GRCm39) missense probably benign
R8448:Ints2 UTSW 11 86,146,249 (GRCm39) missense probably benign
R8784:Ints2 UTSW 11 86,115,941 (GRCm39) nonsense probably null
R8784:Ints2 UTSW 11 86,112,963 (GRCm39) missense probably damaging 1.00
R8942:Ints2 UTSW 11 86,103,720 (GRCm39) missense probably benign 0.00
R9154:Ints2 UTSW 11 86,125,524 (GRCm39) missense probably damaging 1.00
R9397:Ints2 UTSW 11 86,135,311 (GRCm39) missense probably benign 0.01
R9412:Ints2 UTSW 11 86,117,589 (GRCm39) missense probably damaging 0.99
R9472:Ints2 UTSW 11 86,133,824 (GRCm39) missense
R9476:Ints2 UTSW 11 86,135,335 (GRCm39) missense probably benign
R9510:Ints2 UTSW 11 86,135,335 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGGCGCATACCTGAAAGTG -3'
(R):5'- AGACCCTCTGCATTGTTAACC -3'

Sequencing Primer
(F):5'- GAACAAGTTTAGCAATGTTGGGATC -3'
(R):5'- GCCATTCTGTTCATATGAAAATCGGG -3'
Posted On 2021-11-19