Incidental Mutation 'R9037:Serpinb6b'
ID 687487
Institutional Source Beutler Lab
Gene Symbol Serpinb6b
Ensembl Gene ENSMUSG00000042842
Gene Name serine (or cysteine) peptidase inhibitor, clade B, member 6b
Synonyms NK13, ovalbumin, Spi12
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock # R9037 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 32965209-32979067 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 32978015 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 266 (E266*)
Ref Sequence ENSEMBL: ENSMUSP00000105922 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017184] [ENSMUST00000110293] [ENSMUST00000164541]
AlphaFold O08804
Predicted Effect probably benign
Transcript: ENSMUST00000017184
SMART Domains Protein: ENSMUSP00000017184
Gene: ENSMUSG00000042842

DomainStartEndE-ValueType
SERPIN 13 208 1.22e-10 SMART
Predicted Effect probably null
Transcript: ENSMUST00000110293
AA Change: E266*
SMART Domains Protein: ENSMUSP00000105922
Gene: ENSMUSG00000042842
AA Change: E266*

DomainStartEndE-ValueType
SERPIN 13 377 1.99e-174 SMART
Predicted Effect probably null
Transcript: ENSMUST00000164541
AA Change: E147*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim3 T A 18: 61,818,995 I432F probably benign Het
Aco2 C G 15: 81,872,419 probably benign Het
Adcy1 A G 11: 7,137,325 T400A possibly damaging Het
Anapc4 C A 5: 52,864,501 Q642K probably benign Het
Ano8 A G 8: 71,484,444 F160S probably damaging Het
Apob T C 12: 8,016,501 V4490A probably benign Het
Bcar1 A C 8: 111,720,890 F152V probably benign Het
Cacna2d2 A G 9: 107,509,196 D174G probably benign Het
Capn11 T C 17: 45,639,431 K328R probably benign Het
Coro1a A C 7: 126,700,600 M350R probably benign Het
Ctbp1 T A 5: 33,267,008 M24L probably benign Het
Cyp2c55 T A 19: 39,042,093 F456L probably damaging Het
Dnah5 A T 15: 28,247,958 K747M probably benign Het
Esp36 C T 17: 38,418,949 G60D unknown Het
Gast A G 11: 100,336,610 E43G probably damaging Het
Gm11639 A G 11: 104,912,965 D3048G unknown Het
Gm5849 T G 3: 90,777,848 N10T probably benign Het
Gm8765 A G 13: 50,702,908 K861E probably benign Het
Gulp1 T C 1: 44,754,364 S62P probably benign Het
Hectd1 T C 12: 51,785,882 D903G possibly damaging Het
Hk2 T A 6: 82,743,358 I201F probably benign Het
Ifna2 T C 4: 88,683,427 D118G probably benign Het
Ift172 T C 5: 31,263,056 K1079E possibly damaging Het
Igsf9 T C 1: 172,484,514 V9A probably benign Het
Ints2 G A 11: 86,215,704 T960I probably benign Het
Klk12 T C 7: 43,769,715 W35R probably damaging Het
Ly6c1 C A 15: 75,045,451 G116V probably damaging Het
Macf1 T C 4: 123,471,725 N3081S probably benign Het
Mal2 A G 15: 54,571,543 N12S unknown Het
Mgat1 T G 11: 49,261,429 N246K probably damaging Het
Mpeg1 T A 19: 12,461,826 V216E probably damaging Het
Mtmr9 T A 14: 63,524,083 T541S possibly damaging Het
Olfr1047 G T 2: 86,228,698 T91K probably benign Het
Olfr1246 C T 2: 89,590,707 R136Q probably benign Het
Olfr623 T A 7: 103,661,175 H25L probably benign Het
Olfr995 T C 2: 85,438,795 D121G possibly damaging Het
P2rx6 A G 16: 17,570,443 T328A possibly damaging Het
Pcdhb12 A C 18: 37,436,176 E125A probably benign Het
Pde3a C A 6: 141,471,106 Q569K probably damaging Het
Pepd A T 7: 35,020,973 Q227L probably benign Het
Piezo2 T A 18: 63,092,831 E911D probably benign Het
Pnpla6 A T 8: 3,542,379 R1241* probably null Het
Pold1 T C 7: 44,538,915 D513G probably damaging Het
Polr1d A T 5: 147,078,680 I58L probably benign Het
Ppif T C 14: 25,694,404 L58P probably damaging Het
Preb T C 5: 30,959,246 K101R probably benign Het
Psma8 G T 18: 14,721,194 V44L probably benign Het
Ptf1a A G 2: 19,446,225 Y122C possibly damaging Het
Ranbp6 T C 19: 29,812,917 T12A probably benign Het
Rasal3 C A 17: 32,395,120 R587L probably benign Het
Rnf146 T C 10: 29,347,680 K70R probably benign Het
Slc15a2 A T 16: 36,762,363 M252K probably benign Het
Slc2a1 T C 4: 119,136,297 F444L probably damaging Het
Sox9 A G 11: 112,784,824 S280G probably damaging Het
Trappc8 A G 18: 20,828,482 V1243A probably benign Het
Trpv2 A T 11: 62,584,405 T215S probably damaging Het
Ttc39a A G 4: 109,442,784 E490G probably damaging Het
Ush2a A T 1: 188,263,290 D86V possibly damaging Het
Usp24 A G 4: 106,379,054 T980A probably damaging Het
Vwa7 T C 17: 35,017,292 V74A probably benign Het
Zan A G 5: 137,454,316 V1501A unknown Het
Zfp105 A G 9: 122,929,771 E169G possibly damaging Het
Zfp788 C T 7: 41,648,891 T317I probably damaging Het
Other mutations in Serpinb6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Serpinb6b APN 13 32971546 missense probably benign 0.01
IGL01077:Serpinb6b APN 13 32978066 missense possibly damaging 0.68
IGL01553:Serpinb6b APN 13 32974948 missense probably damaging 1.00
IGL02981:Serpinb6b APN 13 32971606 missense probably benign 0.34
R0308:Serpinb6b UTSW 13 32978237 missense probably benign 0.09
R1568:Serpinb6b UTSW 13 32974912 missense probably damaging 1.00
R1692:Serpinb6b UTSW 13 32974995 missense probably damaging 1.00
R1763:Serpinb6b UTSW 13 32978058 missense probably damaging 1.00
R1917:Serpinb6b UTSW 13 32978240 missense probably benign
R1918:Serpinb6b UTSW 13 32978240 missense probably benign
R1919:Serpinb6b UTSW 13 32978240 missense probably benign
R1920:Serpinb6b UTSW 13 32975008 missense possibly damaging 0.47
R3032:Serpinb6b UTSW 13 32968568 missense possibly damaging 0.78
R4239:Serpinb6b UTSW 13 32972263 missense probably damaging 0.96
R5089:Serpinb6b UTSW 13 32978150 missense probably benign
R5503:Serpinb6b UTSW 13 32977659 missense possibly damaging 0.95
R5540:Serpinb6b UTSW 13 32977558 nonsense probably null
R6061:Serpinb6b UTSW 13 32977994 missense probably damaging 0.99
R6253:Serpinb6b UTSW 13 32972272 missense probably damaging 1.00
R7156:Serpinb6b UTSW 13 32971615 missense probably benign 0.09
R7248:Serpinb6b UTSW 13 32977576 missense probably benign 0.23
R7315:Serpinb6b UTSW 13 32972257 missense probably benign 0.41
R7424:Serpinb6b UTSW 13 32968667 missense probably damaging 0.99
R7547:Serpinb6b UTSW 13 32974924 missense probably benign 0.05
R7732:Serpinb6b UTSW 13 32968607 missense probably damaging 1.00
R7770:Serpinb6b UTSW 13 32977529 missense probably benign 0.05
R7802:Serpinb6b UTSW 13 32971596
R8814:Serpinb6b UTSW 13 32978304 missense possibly damaging 0.94
R8966:Serpinb6b UTSW 13 32978052 missense probably damaging 1.00
R8988:Serpinb6b UTSW 13 32978142 missense probably benign 0.45
R9129:Serpinb6b UTSW 13 32978156 small deletion probably benign
R9377:Serpinb6b UTSW 13 32968511 start codon destroyed probably null 1.00
R9415:Serpinb6b UTSW 13 32975019 missense
Predicted Primers PCR Primer
(F):5'- AGAGAACAGAGCTGCTCCCTAG -3'
(R):5'- CCTATATTGGCTGCAGTGGC -3'

Sequencing Primer
(F):5'- AGCTCCTCCCAGTTACCATATTAAG -3'
(R):5'- TTGACCTCCACAAAGGACTTG -3'
Posted On 2021-11-19