Incidental Mutation 'R9038:Arhgef40'
ID 687558
Institutional Source Beutler Lab
Gene Symbol Arhgef40
Ensembl Gene ENSMUSG00000004562
Gene Name Rho guanine nucleotide exchange factor (GEF) 40
Synonyms E130112L23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock # R9038 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 51984719-52006251 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 51997615 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Aspartic acid at position 1083 (A1083D)
Ref Sequence ENSEMBL: ENSMUSP00000091331 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093813] [ENSMUST00000100639] [ENSMUST00000182061] [ENSMUST00000182760] [ENSMUST00000182905] [ENSMUST00000182909] [ENSMUST00000183208]
AlphaFold Q3UPH7
Predicted Effect probably damaging
Transcript: ENSMUST00000093813
AA Change: A1083D

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000091331
Gene: ENSMUSG00000004562
AA Change: A1083D

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
Pfam:RhoGEF 1087 1246 6.1e-9 PFAM
PH 1264 1372 3.97e-8 SMART
low complexity region 1403 1424 N/A INTRINSIC
low complexity region 1478 1491 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100639
AA Change: A1083D

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000098204
Gene: ENSMUSG00000004562
AA Change: A1083D

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
Pfam:RhoGEF 1087 1246 5.9e-9 PFAM
PH 1264 1372 3.97e-8 SMART
low complexity region 1430 1443 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182061
AA Change: A1083D

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138128
Gene: ENSMUSG00000004562
AA Change: A1083D

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
Pfam:RhoGEF 1087 1247 3.7e-9 PFAM
PH 1264 1372 3.97e-8 SMART
low complexity region 1430 1443 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182217
Predicted Effect probably benign
Transcript: ENSMUST00000182412
Predicted Effect probably benign
Transcript: ENSMUST00000182667
Predicted Effect probably benign
Transcript: ENSMUST00000182760
AA Change: A1092D

PolyPhen 2 Score 0.425 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000138125
Gene: ENSMUSG00000004562
AA Change: A1092D

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 782 801 N/A INTRINSIC
low complexity region 894 923 N/A INTRINSIC
low complexity region 967 1005 N/A INTRINSIC
Pfam:RhoGEF 1096 1256 5.9e-9 PFAM
PH 1273 1381 3.97e-8 SMART
low complexity region 1412 1433 N/A INTRINSIC
low complexity region 1487 1500 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000182905
AA Change: A1083D

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000138797
Gene: ENSMUSG00000004562
AA Change: A1083D

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
SCOP:d1kz7a1 1073 1162 4e-7 SMART
Blast:RhoGEF 1087 1157 1e-8 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000182909
AA Change: A1083D

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000138635
Gene: ENSMUSG00000004562
AA Change: A1083D

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
Pfam:RhoGEF 1087 1247 3.9e-9 PFAM
PH 1264 1372 3.97e-8 SMART
low complexity region 1403 1424 N/A INTRINSIC
low complexity region 1478 1491 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183208
SMART Domains Protein: ENSMUSP00000138354
Gene: ENSMUSG00000004562

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein similar to guanosine nucleotide exchange factors for Rho GTPases. The encoded protein contains in its C-terminus a GEF domain involved in exchange activity and a pleckstrin homology domain. Alternatively spliced transcripts that encode different proteins have been described. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A T 19: 29,754,500 Y371N possibly damaging Het
Abcb5 A T 12: 118,931,916 C382S probably benign Het
Abcf2 A G 5: 24,571,193 V296A possibly damaging Het
Aco2 C G 15: 81,872,419 probably benign Het
Acvrl1 A G 15: 101,141,130 D436G possibly damaging Het
Adamts7 A G 9: 90,174,639 I254V Het
Arhgef18 A G 8: 3,453,257 I888V probably benign Het
Arnt2 C A 7: 84,304,851 A275S probably benign Het
Brip1 C T 11: 86,189,773 V156I probably benign Het
Camk4 C A 18: 33,158,900 C204* probably null Het
Cenpe A G 3: 135,218,036 T161A probably benign Het
Chd2 G A 7: 73,455,610 H1256Y probably damaging Het
Chd9 G A 8: 90,989,605 V936I unknown Het
D6Ertd527e A G 6: 87,112,251 *465W probably null Het
Dcaf11 T A 14: 55,565,657 D309E probably damaging Het
Dtna A G 18: 23,610,496 N373S probably benign Het
Eif2b2 A G 12: 85,220,123 D104G probably benign Het
Fras1 A T 5: 96,726,883 T2302S probably benign Het
Gga1 A G 15: 78,884,121 K114E probably damaging Het
Gm12887 A G 4: 121,616,419 probably null Het
Gss A T 2: 155,564,874 I396N Het
H2-M5 T C 17: 36,988,530 I199M possibly damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Ift172 G T 5: 31,284,055 T245K possibly damaging Het
Iqck A G 7: 118,899,658 D173G probably damaging Het
Itga11 A G 9: 62,767,757 N857S possibly damaging Het
Kdm1b C A 13: 47,049,294 S68R probably benign Het
Ly6c1 C A 15: 75,045,451 G116V probably damaging Het
Myo6 G T 9: 80,255,003 V341L unknown Het
Nfkbie C A 17: 45,559,257 A176E probably damaging Het
Nlrp2 C T 7: 5,327,479 M639I probably benign Het
Olfr1090 A T 2: 86,754,010 S243T probably damaging Het
Olfr1140 A G 2: 87,746,781 N195S probably damaging Het
Olfr1512 T A 14: 52,372,259 S265C probably damaging Het
Olfr418 T A 1: 173,270,580 I135N possibly damaging Het
Olfr680-ps1 T C 7: 105,091,226 I138V probably benign Het
Olfr811 T C 10: 129,801,695 T277A probably damaging Het
Pak4 G A 7: 28,564,838 T213M probably damaging Het
Pan2 C T 10: 128,317,941 Q1003* probably null Het
Pde4c G C 8: 70,726,901 V34L probably benign Het
Pi4k2a G A 19: 42,100,796 V199M probably damaging Het
Platr25 T C 13: 62,700,193 E285G probably damaging Het
Polr3e T C 7: 120,937,683 V356A possibly damaging Het
Prcp A G 7: 92,917,809 D243G probably benign Het
Qsox2 T C 2: 26,225,234 T161A probably damaging Het
Rhoj A G 12: 75,308,926 T35A Het
Scn9a T A 2: 66,494,803 M1336L probably damaging Het
Sel1l2 G T 2: 140,275,464 N162K probably damaging Het
Slc15a3 T C 19: 10,843,502 L161P probably damaging Het
Slc4a11 G A 2: 130,691,743 A100V probably damaging Het
Sp1 A G 15: 102,407,885 S41G probably benign Het
Tbx15 A G 3: 99,314,769 M183V probably benign Het
Tfip11 A G 5: 112,333,348 T397A possibly damaging Het
Themis T C 10: 28,781,753 S259P probably damaging Het
Tm7sf2 T C 19: 6,067,142 Y77C probably damaging Het
Tnnt2 C A 1: 135,846,746 P81H possibly damaging Het
Trpc7 T C 13: 56,888,073 T16A probably benign Het
Ttc30a2 G A 2: 75,977,871 T99I probably benign Het
Ttn T A 2: 76,914,712 Y5331F possibly damaging Het
Virma A G 4: 11,526,922 Q1057R possibly damaging Het
Vmn2r118 A T 17: 55,611,649 F81Y probably damaging Het
Vmn2r88 T C 14: 51,414,033 V268A Het
Vmn2r93 T A 17: 18,304,209 M155K probably benign Het
Vps13b G T 15: 35,875,785 C2772F possibly damaging Het
Wdr90 T C 17: 25,857,226 N86D Het
Zbtb34 T C 2: 33,411,236 D431G probably damaging Het
Zc3h3 G A 15: 75,839,388 P408L probably benign Het
Zfp345 A G 2: 150,471,944 Y558H probably benign Het
Zfp583 G A 7: 6,316,544 P490S probably damaging Het
Other mutations in Arhgef40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Arhgef40 APN 14 51988960 missense probably damaging 1.00
IGL00848:Arhgef40 APN 14 51987427 missense probably damaging 1.00
IGL00966:Arhgef40 APN 14 51991698 critical splice donor site probably null
IGL01123:Arhgef40 APN 14 51994346 missense probably damaging 0.99
IGL02110:Arhgef40 APN 14 51989405 missense probably damaging 1.00
IGL02490:Arhgef40 APN 14 51989195 missense probably damaging 0.99
IGL02505:Arhgef40 APN 14 52000863 missense probably damaging 1.00
IGL02636:Arhgef40 APN 14 51997408 missense probably damaging 1.00
R0200:Arhgef40 UTSW 14 51996974 missense probably damaging 0.99
R0496:Arhgef40 UTSW 14 52004907 unclassified probably benign
R0608:Arhgef40 UTSW 14 51996974 missense probably damaging 0.99
R0826:Arhgef40 UTSW 14 52000993 missense probably benign 0.05
R1126:Arhgef40 UTSW 14 51997126 missense probably damaging 0.96
R1330:Arhgef40 UTSW 14 51990156 missense probably benign 0.42
R1612:Arhgef40 UTSW 14 52004081 missense probably damaging 1.00
R1794:Arhgef40 UTSW 14 51989930 missense possibly damaging 0.94
R1844:Arhgef40 UTSW 14 51997623 missense probably damaging 0.99
R2018:Arhgef40 UTSW 14 52003705 missense probably damaging 1.00
R2064:Arhgef40 UTSW 14 51996183 missense probably damaging 1.00
R2321:Arhgef40 UTSW 14 51994276 splice site probably benign
R3877:Arhgef40 UTSW 14 52002285 missense probably damaging 1.00
R4233:Arhgef40 UTSW 14 51990171 missense possibly damaging 0.50
R4596:Arhgef40 UTSW 14 51987224 critical splice donor site probably null
R4676:Arhgef40 UTSW 14 51990959 nonsense probably null
R4703:Arhgef40 UTSW 14 52002310 missense probably damaging 1.00
R4704:Arhgef40 UTSW 14 52002310 missense probably damaging 1.00
R4719:Arhgef40 UTSW 14 52004938 unclassified probably benign
R4915:Arhgef40 UTSW 14 51990099 missense probably damaging 1.00
R4917:Arhgef40 UTSW 14 51990099 missense probably damaging 1.00
R4918:Arhgef40 UTSW 14 51990099 missense probably damaging 1.00
R5097:Arhgef40 UTSW 14 51989689 missense probably damaging 1.00
R5183:Arhgef40 UTSW 14 52004099 missense probably damaging 0.98
R5195:Arhgef40 UTSW 14 51989812 missense possibly damaging 0.68
R5367:Arhgef40 UTSW 14 51989699 missense probably damaging 0.99
R5381:Arhgef40 UTSW 14 51991849 missense probably damaging 0.99
R5594:Arhgef40 UTSW 14 51996157 missense probably damaging 1.00
R5632:Arhgef40 UTSW 14 51994338 missense probably damaging 1.00
R5665:Arhgef40 UTSW 14 52000900 missense possibly damaging 0.80
R5798:Arhgef40 UTSW 14 51997032 missense probably damaging 1.00
R5820:Arhgef40 UTSW 14 51987496 missense possibly damaging 0.76
R6229:Arhgef40 UTSW 14 51990090 missense probably benign 0.06
R6451:Arhgef40 UTSW 14 52000999 missense probably damaging 1.00
R6633:Arhgef40 UTSW 14 51997431 missense probably damaging 1.00
R6642:Arhgef40 UTSW 14 51990962 unclassified probably benign
R6675:Arhgef40 UTSW 14 51991641 missense probably damaging 0.99
R6781:Arhgef40 UTSW 14 51997897 intron probably benign
R6901:Arhgef40 UTSW 14 51997368 missense probably damaging 1.00
R7852:Arhgef40 UTSW 14 51991797 missense unknown
R7857:Arhgef40 UTSW 14 51988755 missense probably damaging 0.97
R7914:Arhgef40 UTSW 14 51987575 missense probably damaging 1.00
R8060:Arhgef40 UTSW 14 51984995 splice site probably benign
R8144:Arhgef40 UTSW 14 51998175 missense probably damaging 1.00
R8195:Arhgef40 UTSW 14 51988769 missense probably damaging 1.00
R8432:Arhgef40 UTSW 14 51989400 missense probably benign 0.00
R8738:Arhgef40 UTSW 14 52000957 missense probably damaging 1.00
R8830:Arhgef40 UTSW 14 52003708 missense probably damaging 1.00
R9712:Arhgef40 UTSW 14 51988958 missense probably damaging 0.99
U24488:Arhgef40 UTSW 14 51998216 missense probably benign 0.07
X0023:Arhgef40 UTSW 14 52003684 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACACGTACTATTGGGCCGG -3'
(R):5'- AGCCCTGAAGCTCTTGTAGAAAG -3'

Sequencing Primer
(F):5'- CCAGATGGACCCTGGGGAATAG -3'
(R):5'- AAGCTCTTGTAGAAAGTGTGTCCC -3'
Posted On 2021-11-19