Mutagenetix > Incidental Mutation

Incidental Mutation 'R9038:Vmn2r118'

687572

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r118

Ensembl Gene

ENSMUSG00000091504

Gene Name

vomeronasal 2, receptor 118

Synonyms

EG383258, Vmn2r119, EG668547

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.141) question?

Stock #

R9038 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

55592341-55624672 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 55611649 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Tyrosine at position 81 (F81Y)

Ref Sequence

ENSEMBL: ENSMUSP00000131128 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168440]

AlphaFold

E9Q1C1

Predicted Effect

probably damaging
Transcript: ENSMUST00000168440
AA Change: F81Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000131128
Gene: ENSMUSG00000091504
AA Change: F81Y

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:ANF_receptor	142	470	4.6e-27	PFAM
Pfam:NCD3G	513	566	2.6e-20	PFAM
Pfam:7tm_3	599	834	5.9e-55	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.8%
10x: 98.9%
20x: 95.4%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930021J03Rik	A	T	19: 29,754,500	Y371N	possibly damaging	Het
Abcb5	A	T	12: 118,931,916	C382S	probably benign	Het
Abcf2	A	G	5: 24,571,193	V296A	possibly damaging	Het
Aco2	C	G	15: 81,872,419		probably benign	Het
Acvrl1	A	G	15: 101,141,130	D436G	possibly damaging	Het
Adamts7	A	G	9: 90,174,639	I254V		Het
Arhgef18	A	G	8: 3,453,257	I888V	probably benign	Het
Arhgef40	C	A	14: 51,997,615	A1083D	probably damaging	Het
Arnt2	C	A	7: 84,304,851	A275S	probably benign	Het
Brip1	C	T	11: 86,189,773	V156I	probably benign	Het
Camk4	C	A	18: 33,158,900	C204*	probably null	Het
Cenpe	A	G	3: 135,218,036	T161A	probably benign	Het
Chd2	G	A	7: 73,455,610	H1256Y	probably damaging	Het
Chd9	G	A	8: 90,989,605	V936I	unknown	Het
D6Ertd527e	A	G	6: 87,112,251	*465W	probably null	Het
Dcaf11	T	A	14: 55,565,657	D309E	probably damaging	Het
Dtna	A	G	18: 23,610,496	N373S	probably benign	Het
Eif2b2	A	G	12: 85,220,123	D104G	probably benign	Het
Fras1	A	T	5: 96,726,883	T2302S	probably benign	Het
Gga1	A	G	15: 78,884,121	K114E	probably damaging	Het
Gm12887	A	G	4: 121,616,419		probably null	Het
Gss	A	T	2: 155,564,874	I396N		Het
H2-M5	T	C	17: 36,988,530	I199M	possibly damaging	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Ift172	G	T	5: 31,284,055	T245K	possibly damaging	Het
Iqck	A	G	7: 118,899,658	D173G	probably damaging	Het
Itga11	A	G	9: 62,767,757	N857S	possibly damaging	Het
Kdm1b	C	A	13: 47,049,294	S68R	probably benign	Het
Ly6c1	C	A	15: 75,045,451	G116V	probably damaging	Het
Myo6	G	T	9: 80,255,003	V341L	unknown	Het
Nfkbie	C	A	17: 45,559,257	A176E	probably damaging	Het
Nlrp2	C	T	7: 5,327,479	M639I	probably benign	Het
Olfr1090	A	T	2: 86,754,010	S243T	probably damaging	Het
Olfr1140	A	G	2: 87,746,781	N195S	probably damaging	Het
Olfr1512	T	A	14: 52,372,259	S265C	probably damaging	Het
Olfr418	T	A	1: 173,270,580	I135N	possibly damaging	Het
Olfr680-ps1	T	C	7: 105,091,226	I138V	probably benign	Het
Olfr811	T	C	10: 129,801,695	T277A	probably damaging	Het
Pak4	G	A	7: 28,564,838	T213M	probably damaging	Het
Pan2	C	T	10: 128,317,941	Q1003*	probably null	Het
Pde4c	G	C	8: 70,726,901	V34L	probably benign	Het
Pi4k2a	G	A	19: 42,100,796	V199M	probably damaging	Het
Platr25	T	C	13: 62,700,193	E285G	probably damaging	Het
Polr3e	T	C	7: 120,937,683	V356A	possibly damaging	Het
Prcp	A	G	7: 92,917,809	D243G	probably benign	Het
Qsox2	T	C	2: 26,225,234	T161A	probably damaging	Het
Rhoj	A	G	12: 75,308,926	T35A		Het
Scn9a	T	A	2: 66,494,803	M1336L	probably damaging	Het
Sel1l2	G	T	2: 140,275,464	N162K	probably damaging	Het
Slc15a3	T	C	19: 10,843,502	L161P	probably damaging	Het
Slc4a11	G	A	2: 130,691,743	A100V	probably damaging	Het
Sp1	A	G	15: 102,407,885	S41G	probably benign	Het
Tbx15	A	G	3: 99,314,769	M183V	probably benign	Het
Tfip11	A	G	5: 112,333,348	T397A	possibly damaging	Het
Themis	T	C	10: 28,781,753	S259P	probably damaging	Het
Tm7sf2	T	C	19: 6,067,142	Y77C	probably damaging	Het
Tnnt2	C	A	1: 135,846,746	P81H	possibly damaging	Het
Trpc7	T	C	13: 56,888,073	T16A	probably benign	Het
Ttc30a2	G	A	2: 75,977,871	T99I	probably benign	Het
Ttn	T	A	2: 76,914,712	Y5331F	possibly damaging	Het
Virma	A	G	4: 11,526,922	Q1057R	possibly damaging	Het
Vmn2r88	T	C	14: 51,414,033	V268A		Het
Vmn2r93	T	A	17: 18,304,209	M155K	probably benign	Het
Vps13b	G	T	15: 35,875,785	C2772F	possibly damaging	Het
Wdr90	T	C	17: 25,857,226	N86D		Het
Zbtb34	T	C	2: 33,411,236	D431G	probably damaging	Het
Zc3h3	G	A	15: 75,839,388	P408L	probably benign	Het
Zfp345	A	G	2: 150,471,944	Y558H	probably benign	Het
Zfp583	G	A	7: 6,316,544	P490S	probably damaging	Het

Other mutations in Vmn2r118

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Vmn2r118	APN	17	55592708	missense	probably damaging	1.00
IGL00976:Vmn2r118	APN	17	55593204	missense	probably damaging	1.00
IGL01419:Vmn2r118	APN	17	55593000	missense	probably benign	0.01
IGL01796:Vmn2r118	APN	17	55608585	missense	probably benign	0.30
IGL01799:Vmn2r118	APN	17	55592990	missense	probably damaging	1.00
IGL02002:Vmn2r118	APN	17	55592619	missense	probably damaging	1.00
IGL02075:Vmn2r118	APN	17	55610517	missense	probably benign	0.18
IGL02172:Vmn2r118	APN	17	55624598	missense	probably benign	0.00
IGL02529:Vmn2r118	APN	17	55610870	missense	possibly damaging	0.58
IGL02712:Vmn2r118	APN	17	55592655	missense	probably benign	0.21
IGL03096:Vmn2r118	APN	17	55607996	missense	probably damaging	1.00
R0306:Vmn2r118	UTSW	17	55608616	missense	possibly damaging	0.89
R0329:Vmn2r118	UTSW	17	55610717	missense	probably damaging	1.00
R0330:Vmn2r118	UTSW	17	55610717	missense	probably damaging	1.00
R0396:Vmn2r118	UTSW	17	55608643	missense	probably benign	0.00
R0411:Vmn2r118	UTSW	17	55611021	splice site	probably benign
R0513:Vmn2r118	UTSW	17	55610970	nonsense	probably null
R0627:Vmn2r118	UTSW	17	55610772	missense	probably benign	0.01
R0638:Vmn2r118	UTSW	17	55608466	missense	probably benign	0.03
R1328:Vmn2r118	UTSW	17	55608620	missense	probably benign	0.01
R1366:Vmn2r118	UTSW	17	55593237	nonsense	probably null
R1465:Vmn2r118	UTSW	17	55610935	missense	probably benign	0.33
R1465:Vmn2r118	UTSW	17	55610935	missense	probably benign	0.33
R1511:Vmn2r118	UTSW	17	55608496	nonsense	probably null
R1515:Vmn2r118	UTSW	17	55610643	missense	probably benign	0.25
R1550:Vmn2r118	UTSW	17	55608083	missense	probably damaging	1.00
R1779:Vmn2r118	UTSW	17	55611530	missense	probably benign	0.03
R1834:Vmn2r118	UTSW	17	55592456	missense	probably damaging	1.00
R1840:Vmn2r118	UTSW	17	55610406	nonsense	probably null
R1854:Vmn2r118	UTSW	17	55611556	missense	possibly damaging	0.57
R1967:Vmn2r118	UTSW	17	55592882	missense	probably damaging	1.00
R1976:Vmn2r118	UTSW	17	55592925	missense	probably damaging	1.00
R2308:Vmn2r118	UTSW	17	55624650	missense	probably benign	0.33
R3700:Vmn2r118	UTSW	17	55608421	missense	possibly damaging	0.68
R4334:Vmn2r118	UTSW	17	55610347	missense	possibly damaging	0.58
R4647:Vmn2r118	UTSW	17	55610665	missense	probably damaging	1.00
R4709:Vmn2r118	UTSW	17	55610860	missense	probably damaging	1.00
R4805:Vmn2r118	UTSW	17	55592581	missense	probably damaging	1.00
R4858:Vmn2r118	UTSW	17	55592894	missense	probably damaging	0.98
R5384:Vmn2r118	UTSW	17	55611565	missense	probably benign	0.00
R5385:Vmn2r118	UTSW	17	55611565	missense	probably benign	0.00
R5664:Vmn2r118	UTSW	17	55592765	missense	possibly damaging	0.46
R5740:Vmn2r118	UTSW	17	55593103	missense	probably benign	0.00
R5927:Vmn2r118	UTSW	17	55624494	missense	probably benign	0.04
R6143:Vmn2r118	UTSW	17	55592871	missense	possibly damaging	0.92
R6513:Vmn2r118	UTSW	17	55608093	missense	probably damaging	1.00
R6573:Vmn2r118	UTSW	17	55592996	missense	probably damaging	1.00
R6760:Vmn2r118	UTSW	17	55592714	missense	possibly damaging	0.92
R6794:Vmn2r118	UTSW	17	55592348	missense	possibly damaging	0.48
R6929:Vmn2r118	UTSW	17	55610440	missense	probably benign	0.01
R7201:Vmn2r118	UTSW	17	55608496	nonsense	probably null
R7539:Vmn2r118	UTSW	17	55592853	missense	probably damaging	0.98
R7836:Vmn2r118	UTSW	17	55593242	missense	probably damaging	0.99
R8179:Vmn2r118	UTSW	17	55608484	missense	probably benign	0.36
R8248:Vmn2r118	UTSW	17	55610936	missense	probably benign	0.18
R8347:Vmn2r118	UTSW	17	55610423	missense	possibly damaging	0.94
R8415:Vmn2r118	UTSW	17	55608057	missense	probably benign	0.08
R8428:Vmn2r118	UTSW	17	55608642	missense	probably benign	0.33
R8917:Vmn2r118	UTSW	17	55610216	missense	possibly damaging	0.82
R8993:Vmn2r118	UTSW	17	55610835	missense	possibly damaging	0.72
R9155:Vmn2r118	UTSW	17	55610207	missense	probably null	0.83
R9603:Vmn2r118	UTSW	17	55592837	missense	probably damaging	1.00
R9742:Vmn2r118	UTSW	17	55611009	missense	probably damaging	0.98
R9749:Vmn2r118	UTSW	17	55608415	critical splice donor site	probably null
R9792:Vmn2r118	UTSW	17	55592496	missense	probably damaging	0.99
R9793:Vmn2r118	UTSW	17	55592496	missense	probably damaging	0.99
R9795:Vmn2r118	UTSW	17	55592496	missense	probably damaging	0.99
X0022:Vmn2r118	UTSW	17	55593218	missense	probably damaging	1.00
Z1176:Vmn2r118	UTSW	17	55610655	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ATGCACCGGGATCACAGATG -3'
(R):5'- AGGTTCACAGAGGCATATACATC -3'

Sequencing Primer
(F):5'- TGCACCGGGATCACAGATGTAATTAG -3'
(R):5'- CACAGAGGCATATACATCTTTTGC -3'

Posted On

2021-11-19