Incidental Mutation 'R9038:Vmn2r118'
ID 687572
Institutional Source Beutler Lab
Gene Symbol Vmn2r118
Ensembl Gene ENSMUSG00000091504
Gene Name vomeronasal 2, receptor 118
Synonyms Vmn2r119, EG668547, EG383258
MMRRC Submission 068866-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.128) question?
Stock # R9038 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 55899341-55931672 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 55918649 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 81 (F81Y)
Ref Sequence ENSEMBL: ENSMUSP00000131128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168440]
AlphaFold E9Q1C1
Predicted Effect probably damaging
Transcript: ENSMUST00000168440
AA Change: F81Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131128
Gene: ENSMUSG00000091504
AA Change: F81Y

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 142 470 4.6e-27 PFAM
Pfam:NCD3G 513 566 2.6e-20 PFAM
Pfam:7tm_3 599 834 5.9e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A T 12: 118,895,651 (GRCm39) C382S probably benign Het
Abcf2 A G 5: 24,776,191 (GRCm39) V296A possibly damaging Het
Aco2 C G 15: 81,756,620 (GRCm39) probably benign Het
Acvrl1 A G 15: 101,039,011 (GRCm39) D436G possibly damaging Het
Adamts7 A G 9: 90,056,692 (GRCm39) I254V Het
Arhgef18 A G 8: 3,503,257 (GRCm39) I888V probably benign Het
Arhgef40 C A 14: 52,235,072 (GRCm39) A1083D probably damaging Het
Arnt2 C A 7: 83,954,059 (GRCm39) A275S probably benign Het
Brd10 A T 19: 29,731,900 (GRCm39) Y371N possibly damaging Het
Brip1 C T 11: 86,080,599 (GRCm39) V156I probably benign Het
Camk4 C A 18: 33,291,953 (GRCm39) C204* probably null Het
Cenpe A G 3: 134,923,797 (GRCm39) T161A probably benign Het
Chd2 G A 7: 73,105,358 (GRCm39) H1256Y probably damaging Het
Chd9 G A 8: 91,716,233 (GRCm39) V936I unknown Het
D6Ertd527e A G 6: 87,089,233 (GRCm39) *465W probably null Het
Dcaf11 T A 14: 55,803,114 (GRCm39) D309E probably damaging Het
Dtna A G 18: 23,743,553 (GRCm39) N373S probably benign Het
Eif2b2 A G 12: 85,266,897 (GRCm39) D104G probably benign Het
Fras1 A T 5: 96,874,742 (GRCm39) T2302S probably benign Het
Gga1 A G 15: 78,768,321 (GRCm39) K114E probably damaging Het
Gm12887 A G 4: 121,473,616 (GRCm39) probably null Het
Gss A T 2: 155,406,794 (GRCm39) I396N Het
H2-M5 T C 17: 37,299,422 (GRCm39) I199M possibly damaging Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Ift172 G T 5: 31,441,399 (GRCm39) T245K possibly damaging Het
Ift70a2 G A 2: 75,808,215 (GRCm39) T99I probably benign Het
Iqck A G 7: 118,498,881 (GRCm39) D173G probably damaging Het
Itga11 A G 9: 62,675,039 (GRCm39) N857S possibly damaging Het
Kdm1b C A 13: 47,202,770 (GRCm39) S68R probably benign Het
Ly6c1 C A 15: 74,917,300 (GRCm39) G116V probably damaging Het
Myo6 G T 9: 80,162,285 (GRCm39) V341L unknown Het
Nfkbie C A 17: 45,870,183 (GRCm39) A176E probably damaging Het
Nlrp2 C T 7: 5,330,478 (GRCm39) M639I probably benign Het
Or10g3 T A 14: 52,609,716 (GRCm39) S265C probably damaging Het
Or10j2 T A 1: 173,098,147 (GRCm39) I135N possibly damaging Het
Or56a41 T C 7: 104,740,433 (GRCm39) I138V probably benign Het
Or5w16 A G 2: 87,577,125 (GRCm39) N195S probably damaging Het
Or6c215 T C 10: 129,637,564 (GRCm39) T277A probably damaging Het
Or8k40 A T 2: 86,584,354 (GRCm39) S243T probably damaging Het
Pak4 G A 7: 28,264,263 (GRCm39) T213M probably damaging Het
Pan2 C T 10: 128,153,810 (GRCm39) Q1003* probably null Het
Pde4c G C 8: 71,179,550 (GRCm39) V34L probably benign Het
Pi4k2a G A 19: 42,089,235 (GRCm39) V199M probably damaging Het
Platr25 T C 13: 62,848,007 (GRCm39) E285G probably damaging Het
Polr3e T C 7: 120,536,906 (GRCm39) V356A possibly damaging Het
Prcp A G 7: 92,567,017 (GRCm39) D243G probably benign Het
Qsox2 T C 2: 26,115,246 (GRCm39) T161A probably damaging Het
Rhoj A G 12: 75,355,700 (GRCm39) T35A Het
Scn9a T A 2: 66,325,147 (GRCm39) M1336L probably damaging Het
Sel1l2 G T 2: 140,117,384 (GRCm39) N162K probably damaging Het
Slc15a3 T C 19: 10,820,866 (GRCm39) L161P probably damaging Het
Slc4a11 G A 2: 130,533,663 (GRCm39) A100V probably damaging Het
Sp1 A G 15: 102,316,320 (GRCm39) S41G probably benign Het
Tbx15 A G 3: 99,222,085 (GRCm39) M183V probably benign Het
Tfip11 A G 5: 112,481,214 (GRCm39) T397A possibly damaging Het
Themis T C 10: 28,657,749 (GRCm39) S259P probably damaging Het
Tm7sf2 T C 19: 6,117,172 (GRCm39) Y77C probably damaging Het
Tnnt2 C A 1: 135,774,484 (GRCm39) P81H possibly damaging Het
Trpc7 T C 13: 57,035,886 (GRCm39) T16A probably benign Het
Ttn T A 2: 76,745,056 (GRCm39) Y5331F possibly damaging Het
Virma A G 4: 11,526,922 (GRCm39) Q1057R possibly damaging Het
Vmn2r88 T C 14: 51,651,490 (GRCm39) V268A Het
Vmn2r93 T A 17: 18,524,471 (GRCm39) M155K probably benign Het
Vps13b G T 15: 35,875,931 (GRCm39) C2772F possibly damaging Het
Wdr90 T C 17: 26,076,200 (GRCm39) N86D Het
Zbtb34 T C 2: 33,301,248 (GRCm39) D431G probably damaging Het
Zc3h3 G A 15: 75,711,237 (GRCm39) P408L probably benign Het
Zfp345 A G 2: 150,313,864 (GRCm39) Y558H probably benign Het
Zfp583 G A 7: 6,319,543 (GRCm39) P490S probably damaging Het
Other mutations in Vmn2r118
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Vmn2r118 APN 17 55,899,708 (GRCm39) missense probably damaging 1.00
IGL00976:Vmn2r118 APN 17 55,900,204 (GRCm39) missense probably damaging 1.00
IGL01419:Vmn2r118 APN 17 55,900,000 (GRCm39) missense probably benign 0.01
IGL01796:Vmn2r118 APN 17 55,915,585 (GRCm39) missense probably benign 0.30
IGL01799:Vmn2r118 APN 17 55,899,990 (GRCm39) missense probably damaging 1.00
IGL02002:Vmn2r118 APN 17 55,899,619 (GRCm39) missense probably damaging 1.00
IGL02075:Vmn2r118 APN 17 55,917,517 (GRCm39) missense probably benign 0.18
IGL02172:Vmn2r118 APN 17 55,931,598 (GRCm39) missense probably benign 0.00
IGL02529:Vmn2r118 APN 17 55,917,870 (GRCm39) missense possibly damaging 0.58
IGL02712:Vmn2r118 APN 17 55,899,655 (GRCm39) missense probably benign 0.21
IGL03096:Vmn2r118 APN 17 55,914,996 (GRCm39) missense probably damaging 1.00
R0306:Vmn2r118 UTSW 17 55,915,616 (GRCm39) missense possibly damaging 0.89
R0329:Vmn2r118 UTSW 17 55,917,717 (GRCm39) missense probably damaging 1.00
R0330:Vmn2r118 UTSW 17 55,917,717 (GRCm39) missense probably damaging 1.00
R0396:Vmn2r118 UTSW 17 55,915,643 (GRCm39) missense probably benign 0.00
R0411:Vmn2r118 UTSW 17 55,918,021 (GRCm39) splice site probably benign
R0513:Vmn2r118 UTSW 17 55,917,970 (GRCm39) nonsense probably null
R0627:Vmn2r118 UTSW 17 55,917,772 (GRCm39) missense probably benign 0.01
R0638:Vmn2r118 UTSW 17 55,915,466 (GRCm39) missense probably benign 0.03
R1328:Vmn2r118 UTSW 17 55,915,620 (GRCm39) missense probably benign 0.01
R1366:Vmn2r118 UTSW 17 55,900,237 (GRCm39) nonsense probably null
R1465:Vmn2r118 UTSW 17 55,917,935 (GRCm39) missense probably benign 0.33
R1465:Vmn2r118 UTSW 17 55,917,935 (GRCm39) missense probably benign 0.33
R1511:Vmn2r118 UTSW 17 55,915,496 (GRCm39) nonsense probably null
R1515:Vmn2r118 UTSW 17 55,917,643 (GRCm39) missense probably benign 0.25
R1550:Vmn2r118 UTSW 17 55,915,083 (GRCm39) missense probably damaging 1.00
R1779:Vmn2r118 UTSW 17 55,918,530 (GRCm39) missense probably benign 0.03
R1834:Vmn2r118 UTSW 17 55,899,456 (GRCm39) missense probably damaging 1.00
R1840:Vmn2r118 UTSW 17 55,917,406 (GRCm39) nonsense probably null
R1854:Vmn2r118 UTSW 17 55,918,556 (GRCm39) missense possibly damaging 0.57
R1967:Vmn2r118 UTSW 17 55,899,882 (GRCm39) missense probably damaging 1.00
R1976:Vmn2r118 UTSW 17 55,899,925 (GRCm39) missense probably damaging 1.00
R2308:Vmn2r118 UTSW 17 55,931,650 (GRCm39) missense probably benign 0.33
R3700:Vmn2r118 UTSW 17 55,915,421 (GRCm39) missense possibly damaging 0.68
R4334:Vmn2r118 UTSW 17 55,917,347 (GRCm39) missense possibly damaging 0.58
R4647:Vmn2r118 UTSW 17 55,917,665 (GRCm39) missense probably damaging 1.00
R4709:Vmn2r118 UTSW 17 55,917,860 (GRCm39) missense probably damaging 1.00
R4805:Vmn2r118 UTSW 17 55,899,581 (GRCm39) missense probably damaging 1.00
R4858:Vmn2r118 UTSW 17 55,899,894 (GRCm39) missense probably damaging 0.98
R5384:Vmn2r118 UTSW 17 55,918,565 (GRCm39) missense probably benign 0.00
R5385:Vmn2r118 UTSW 17 55,918,565 (GRCm39) missense probably benign 0.00
R5664:Vmn2r118 UTSW 17 55,899,765 (GRCm39) missense possibly damaging 0.46
R5740:Vmn2r118 UTSW 17 55,900,103 (GRCm39) missense probably benign 0.00
R5927:Vmn2r118 UTSW 17 55,931,494 (GRCm39) missense probably benign 0.04
R6143:Vmn2r118 UTSW 17 55,899,871 (GRCm39) missense possibly damaging 0.92
R6513:Vmn2r118 UTSW 17 55,915,093 (GRCm39) missense probably damaging 1.00
R6573:Vmn2r118 UTSW 17 55,899,996 (GRCm39) missense probably damaging 1.00
R6760:Vmn2r118 UTSW 17 55,899,714 (GRCm39) missense possibly damaging 0.92
R6794:Vmn2r118 UTSW 17 55,899,348 (GRCm39) missense possibly damaging 0.48
R6929:Vmn2r118 UTSW 17 55,917,440 (GRCm39) missense probably benign 0.01
R7201:Vmn2r118 UTSW 17 55,915,496 (GRCm39) nonsense probably null
R7539:Vmn2r118 UTSW 17 55,899,853 (GRCm39) missense probably damaging 0.98
R7836:Vmn2r118 UTSW 17 55,900,242 (GRCm39) missense probably damaging 0.99
R8179:Vmn2r118 UTSW 17 55,915,484 (GRCm39) missense probably benign 0.36
R8248:Vmn2r118 UTSW 17 55,917,936 (GRCm39) missense probably benign 0.18
R8347:Vmn2r118 UTSW 17 55,917,423 (GRCm39) missense possibly damaging 0.94
R8415:Vmn2r118 UTSW 17 55,915,057 (GRCm39) missense probably benign 0.08
R8428:Vmn2r118 UTSW 17 55,915,642 (GRCm39) missense probably benign 0.33
R8917:Vmn2r118 UTSW 17 55,917,216 (GRCm39) missense possibly damaging 0.82
R8993:Vmn2r118 UTSW 17 55,917,835 (GRCm39) missense possibly damaging 0.72
R9155:Vmn2r118 UTSW 17 55,917,207 (GRCm39) missense probably null 0.83
R9603:Vmn2r118 UTSW 17 55,899,837 (GRCm39) missense probably damaging 1.00
R9742:Vmn2r118 UTSW 17 55,918,009 (GRCm39) missense probably damaging 0.98
R9749:Vmn2r118 UTSW 17 55,915,415 (GRCm39) critical splice donor site probably null
R9792:Vmn2r118 UTSW 17 55,899,496 (GRCm39) missense probably damaging 0.99
R9793:Vmn2r118 UTSW 17 55,899,496 (GRCm39) missense probably damaging 0.99
R9795:Vmn2r118 UTSW 17 55,899,496 (GRCm39) missense probably damaging 0.99
X0022:Vmn2r118 UTSW 17 55,900,218 (GRCm39) missense probably damaging 1.00
Z1176:Vmn2r118 UTSW 17 55,917,655 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATGCACCGGGATCACAGATG -3'
(R):5'- AGGTTCACAGAGGCATATACATC -3'

Sequencing Primer
(F):5'- TGCACCGGGATCACAGATGTAATTAG -3'
(R):5'- CACAGAGGCATATACATCTTTTGC -3'
Posted On 2021-11-19