Incidental Mutation 'R9038:Camk4'
ID687574
Institutional Source Beutler Lab
Gene Symbol Camk4
Ensembl Gene ENSMUSG00000038128
Gene Namecalcium/calmodulin-dependent protein kinase IV
SynonymsD18Bwg0362e, CaMKIV/Gr, CaMKIV, Ca2+/calmodulin-dependent protein kinase type IV/Gr, A430110E23Rik
Accession Numbers

Genbank: NM_009793; MGI: 88258

Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R9038 (G1)
Quality Score192.009
Status Not validated
Chromosome18
Chromosomal Location32939041-33195767 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 33158900 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 204 (C204*)
Ref Sequence ENSEMBL: ENSMUSP00000046539 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042868]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000042868
AA Change: C204*
SMART Domains Protein: ENSMUSP00000046539
Gene: ENSMUSG00000038128
AA Change: C204*

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
S_TKc 42 296 8.7e-106 SMART
low complexity region 318 344 N/A INTRINSIC
low complexity region 373 390 N/A INTRINSIC
low complexity region 415 428 N/A INTRINSIC
low complexity region 441 454 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the serine/threonine protein kinase family, and to the Ca(2+)/calmodulin-dependent protein kinase subfamily. This enzyme is a multifunctional serine/threonine protein kinase with limited tissue distribution, that has been implicated in transcriptional regulation in lymphocytes, neurons and male germ cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for different targeted mutations show variable phenotypes, including reduced viability, male and/or female sterility, and mild to severe neurological and spatial memory disorders. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(3) Targeted, other(1)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A T 19: 29,754,500 Y371N possibly damaging Het
Abcb5 A T 12: 118,931,916 C382S probably benign Het
Abcf2 A G 5: 24,571,193 V296A possibly damaging Het
Aco2 C G 15: 81,872,419 probably benign Het
Acvrl1 A G 15: 101,141,130 D436G possibly damaging Het
Adamts7 A G 9: 90,174,639 I254V Het
Arhgef18 A G 8: 3,453,257 I888V probably benign Het
Arhgef40 C A 14: 51,997,615 A1083D probably damaging Het
Arnt2 C A 7: 84,304,851 A275S probably benign Het
Brip1 C T 11: 86,189,773 V156I probably benign Het
Cenpe A G 3: 135,218,036 T161A probably benign Het
Chd2 G A 7: 73,455,610 H1256Y probably damaging Het
Chd9 G A 8: 90,989,605 V936I unknown Het
D6Ertd527e A G 6: 87,112,251 *465W probably null Het
Dcaf11 T A 14: 55,565,657 D309E probably damaging Het
Dtna A G 18: 23,610,496 N373S probably benign Het
Eif2b2 A G 12: 85,220,123 D104G probably benign Het
Fras1 A T 5: 96,726,883 T2302S probably benign Het
Gga1 A G 15: 78,884,121 K114E probably damaging Het
Gm12887 A G 4: 121,616,419 probably null Het
Gss A T 2: 155,564,874 I396N Het
H2-M5 T C 17: 36,988,530 I199M possibly damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Ift172 G T 5: 31,284,055 T245K possibly damaging Het
Iqck A G 7: 118,899,658 D173G probably damaging Het
Itga11 A G 9: 62,767,757 N857S possibly damaging Het
Kdm1b C A 13: 47,049,294 S68R probably benign Het
Ly6c1 C A 15: 75,045,451 G116V probably damaging Het
Myo6 G T 9: 80,255,003 V341L unknown Het
Nfkbie C A 17: 45,559,257 A176E probably damaging Het
Nlrp2 C T 7: 5,327,479 M639I probably benign Het
Olfr1090 A T 2: 86,754,010 S243T probably damaging Het
Olfr1140 A G 2: 87,746,781 N195S probably damaging Het
Olfr1512 T A 14: 52,372,259 S265C probably damaging Het
Olfr418 T A 1: 173,270,580 I135N possibly damaging Het
Olfr680-ps1 T C 7: 105,091,226 I138V probably benign Het
Olfr811 T C 10: 129,801,695 T277A probably damaging Het
Pak4 G A 7: 28,564,838 T213M probably damaging Het
Pan2 C T 10: 128,317,941 Q1003* probably null Het
Pde4c G C 8: 70,726,901 V34L probably benign Het
Pi4k2a G A 19: 42,100,796 V199M probably damaging Het
Platr25 T C 13: 62,700,193 E285G probably damaging Het
Polr3e T C 7: 120,937,683 V356A possibly damaging Het
Prcp A G 7: 92,917,809 D243G probably benign Het
Qsox2 T C 2: 26,225,234 T161A probably damaging Het
Rhoj A G 12: 75,308,926 T35A Het
Scn9a T A 2: 66,494,803 M1336L probably damaging Het
Sel1l2 G T 2: 140,275,464 N162K probably damaging Het
Slc15a3 T C 19: 10,843,502 L161P probably damaging Het
Slc4a11 G A 2: 130,691,743 A100V probably damaging Het
Sp1 A G 15: 102,407,885 S41G probably benign Het
Tbx15 A G 3: 99,314,769 M183V probably benign Het
Tfip11 A G 5: 112,333,348 T397A possibly damaging Het
Themis T C 10: 28,781,753 S259P probably damaging Het
Tm7sf2 T C 19: 6,067,142 Y77C probably damaging Het
Tnnt2 C A 1: 135,846,746 P81H possibly damaging Het
Trpc7 T C 13: 56,888,073 T16A probably benign Het
Ttc30a2 G A 2: 75,977,871 T99I probably benign Het
Ttn T A 2: 76,914,712 Y5331F possibly damaging Het
Virma A G 4: 11,526,922 Q1057R possibly damaging Het
Vmn2r118 A T 17: 55,611,649 F81Y probably damaging Het
Vmn2r88 T C 14: 51,414,033 V268A Het
Vmn2r93 T A 17: 18,304,209 M155K probably benign Het
Vps13b G T 15: 35,875,785 C2772F possibly damaging Het
Wdr90 T C 17: 25,857,226 N86D Het
Zbtb34 T C 2: 33,411,236 D431G probably damaging Het
Zc3h3 G A 15: 75,839,388 P408L probably benign Het
Zfp345 A G 2: 150,471,944 Y558H probably benign Het
Zfp583 G A 7: 6,316,544 P490S probably damaging Het
Other mutations in Camk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
7510:Camk4 UTSW 18 33156839 missense probably null 0.99
R0244:Camk4 UTSW 18 33179625 critical splice donor site probably null
R0408:Camk4 UTSW 18 33129792 missense probably damaging 1.00
R0744:Camk4 UTSW 18 32939454 missense unknown
R0836:Camk4 UTSW 18 32939454 missense unknown
R0903:Camk4 UTSW 18 33182330 missense probably benign 0.08
R1449:Camk4 UTSW 18 32939475 missense probably damaging 0.99
R1456:Camk4 UTSW 18 33129843 splice site probably benign
R1677:Camk4 UTSW 18 33176222 missense probably damaging 1.00
R1733:Camk4 UTSW 18 33078021 missense possibly damaging 0.54
R1909:Camk4 UTSW 18 33158816 splice site probably null
R2186:Camk4 UTSW 18 33182341 missense probably damaging 0.99
R2291:Camk4 UTSW 18 33107943 critical splice donor site probably null
R3874:Camk4 UTSW 18 33158854 missense possibly damaging 0.70
R3968:Camk4 UTSW 18 33179581 missense possibly damaging 0.94
R3969:Camk4 UTSW 18 33179581 missense possibly damaging 0.94
R3970:Camk4 UTSW 18 33179581 missense possibly damaging 0.94
R4858:Camk4 UTSW 18 33176213 missense probably damaging 0.98
R5251:Camk4 UTSW 18 33184879 missense probably benign 0.31
R5343:Camk4 UTSW 18 33078069 missense probably damaging 0.99
R5972:Camk4 UTSW 18 33107926 missense probably damaging 1.00
R6155:Camk4 UTSW 18 32939447 missense unknown
R6728:Camk4 UTSW 18 33184939 missense probably benign
R7088:Camk4 UTSW 18 32939531 missense probably benign 0.02
R7135:Camk4 UTSW 18 33107943 critical splice donor site probably null
R7372:Camk4 UTSW 18 33185125 missense probably benign 0.34
R7490:Camk4 UTSW 18 32939545 critical splice donor site probably null
R7525:Camk4 UTSW 18 33185032 missense probably benign 0.04
R7890:Camk4 UTSW 18 33185005 missense probably benign 0.01
R8446:Camk4 UTSW 18 33156757 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACTGGGTCAGGAGTCAACAG -3'
(R):5'- ACACAGGTGTCCTACATTCCATG -3'

Sequencing Primer
(F):5'- GTCAGGAGTCAACAGATACATTTG -3'
(R):5'- ACATTCCATGTCACTGAGGC -3'
Posted On2021-11-19